View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_low_31 (Length: 222)
Name: NF7573_low_31
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 53454191 - 53454150
Alignment:
| Q |
162 |
gcaccaaacctgtccaagtacagttcgtggcaacctatcttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53454191 |
gcaccaaacctgtccaagtacagttcgtggcaacctatcttt |
53454150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University