View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7573_low_31 (Length: 222)

Name: NF7573_low_31
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7573_low_31
NF7573_low_31
[»] chr4 (1 HSPs)
chr4 (162-203)||(53454150-53454191)


Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 53454191 - 53454150
Alignment:
162 gcaccaaacctgtccaagtacagttcgtggcaacctatcttt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||    
53454191 gcaccaaacctgtccaagtacagttcgtggcaacctatcttt 53454150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University