View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7574_high_9 (Length: 248)
Name: NF7574_high_9
Description: NF7574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7574_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 52605422 - 52605651
Alignment:
| Q |
1 |
atggaattttgaacataaatgatgagtaaattaaggagtgaaaagtgcaacattccgttccttagaatttgcaacctagttaacaaaaaggtcctctcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52605422 |
atggaattttgaacataaatgatgagtaaattaaggagtgaaaagtgcaacattccgttccttagaatttgcaacctagttaacaaaaaggtcctctcct |
52605521 |
T |
 |
| Q |
101 |
ctaatatccgatagattagagaaaattccttgttgaatatggggggaggtagctatggctttaccacgtgatgctcgaattaaggaccatgcttgaaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52605522 |
ctaatatccgatagattagagaaaatt-cttgttgaatat-gggggaggtagctatggctttatcacgtgatgctcgaattaaggaccatgcttgaaaag |
52605619 |
T |
 |
| Q |
201 |
ctgacacttattgagaggaaaaaaggagtttg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52605620 |
ctgacacttattgagaggaaaaaaggagtttg |
52605651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University