View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7576_high_7 (Length: 282)
Name: NF7576_high_7
Description: NF7576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7576_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 36412355 - 36412088
Alignment:
| Q |
1 |
gaagcgtcgtatagtgctatggtttctgggtatgttaggaacggttttttcagtgagggagttcaactattccgggagttgaagaagaaggacaagggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36412355 |
gaagcgtcgtatagtgctatggtttctgggtatgttaggaacggttttttcagtgagggagttcaactattccgggagttgaagaagaaggacaagggtt |
36412256 |
T |
|
| Q |
101 |
gtgcatgtgtgaaattcaatggggctcttttggtgagtgttcttaacgcgtgtacaatggtgggtgcttttgaagaagggaaatggattcattcttatgt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36412255 |
gtgcatgtttgaaattcaatggggctcttttggtgagtgttcttaacgcgtgtacaatggtgggtgcttttgaagaagggaaatggattcattcttatgt |
36412156 |
T |
|
| Q |
201 |
tgaggaaaatgggttggaatatgatcttgagcttggaactgcactgattgatttctacatgaaatgtg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36412155 |
tgaggaaaatgggttggaatatgatcttgagcttggaactgcactgattgatttctacatgaaatgtg |
36412088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 52096847 - 52096580
Alignment:
| Q |
1 |
gaagcgtcgtatagtgctatggtttctgggtatgttaggaacggttttttcagtgagggagttcaactattccgggagttgaagaagaaggacaagggtt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52096847 |
gaagcgtcgaatagtgctatggtttctgggtatgttaggaacagttttttcagtgagggagttcaactattccgggagttgaagaagaaggacaagggtc |
52096748 |
T |
|
| Q |
101 |
gtgcatgtgtgaaattcaatggggctcttttggtgagtgttcttaacgcgtgtacaatggtgggtgcttttgaagaagggaaatggattcattcttatgt |
200 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52096747 |
gtgcacgtgtgaagttcaatggggctcttttggtgagtgttcttaacgcgtgtacagtgatgggtgcttttgaagaagggaaatggattcattcttatgt |
52096648 |
T |
|
| Q |
201 |
tgaggaaaatgggttggaatatgatcttgagcttggaactgcactgattgatttctacatgaaatgtg |
268 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52096647 |
tgaggaaaacggtttggaatatgatcttgagcttggaactgcactgattgatttctacgcgaaatgtg |
52096580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University