View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7576_low_11 (Length: 234)
Name: NF7576_low_11
Description: NF7576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7576_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 5116610 - 5116408
Alignment:
| Q |
19 |
gttgaggcttttgatttcatgttattctcgcttatctcaaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgcattttctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5116610 |
gttgaggcttttgatttcatgttattctcgtttatctcaaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgccttttctct |
5116511 |
T |
 |
| Q |
119 |
tgtttcaaacgttctgattaaacttctttcatcttaaaacagggctagagttgcattaataacttatcttccaaacagactcaaagatgccaatctcatc |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5116510 |
tgtttcaaacgttctaattaaacttctttcatcttaaaacagggctagagttgcattaacaacttatcttccaaacaggctcaaagatgccaatctcatc |
5116411 |
T |
 |
| Q |
219 |
aat |
221 |
Q |
| |
|
||| |
|
|
| T |
5116410 |
aat |
5116408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University