View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7576_low_6 (Length: 298)
Name: NF7576_low_6
Description: NF7576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7576_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 287
Target Start/End: Original strand, 13646225 - 13646496
Alignment:
| Q |
16 |
caatgttcagctccgtacgttacaagtcattgaggtgttacaaaatggttgattcgggctattcgttggaagcattgatgagactgaaggattcaagata |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||| ||||||||||| || |
|
|
| T |
13646225 |
caatgttcaactccgtacgttacaagtcattgaggtgttacaaaatggatgattctagctattcgttcgaagcattgatgagactaaaggattcaaggta |
13646324 |
T |
|
| Q |
116 |
cttagtaaagtagatgagtttgggccataatgtttatttgggtcttgtaggcctgaatttgataacatttcagcttttacctttgatgtttgcatgaatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
13646325 |
cttagtaaagtagatgagtttgggccataatgtttatttgggtcttgtaggcctgaatttgataacatttcagcttttatctttgatgtttgcaggaatg |
13646424 |
T |
|
| Q |
216 |
aatctcttgatatgactgggtgcgtgatgttctgttatggcagatttctgcggcttgaaatgatcgtgtgtg |
287 |
Q |
| |
|
|||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13646425 |
aatctcttgatatggctgggtgcatgatgttatgttatggcagatttctgcggcttgaaatgatcgtgtgtg |
13646496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 229
Target Start/End: Complemental strand, 8752344 - 8752286
Alignment:
| Q |
171 |
aatttgataacatttcagcttttacctttgatgtttgcatgaatgaatctcttgatatg |
229 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
8752344 |
aatttgataacattttagcttttatctttaatgtttgcaggaatgaatctcgtgatatg |
8752286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University