View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7576_low_8 (Length: 270)
Name: NF7576_low_8
Description: NF7576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7576_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 13 - 252
Target Start/End: Complemental strand, 55865855 - 55865616
Alignment:
| Q |
13 |
attcttagaataggaaccatcggcagcggaaagggtgagacggtaattagtcccagcaaccacctgagattcaccgttgataactttctcgaacttcagc |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55865855 |
attcttagaataggaaccatcggaagcggaaagggtgagacggtaattagtcccagcaaccacctgagattcaccgttgataactttctcgaacttcagc |
55865756 |
T |
 |
| Q |
113 |
ttcgctccacttcgcctgtcatactcagtgacggcgaaattggcgatttcggtgacatgaggatcgttgatgtcatcgatgggactccatccaccaggcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55865755 |
ttcgctccacttcgcctgtcatactcagtgacggcgaaattggcgatttcggtgacatgaggatcgttgatgtcatcgatgggactccatccaccaggcg |
55865656 |
T |
 |
| Q |
213 |
caaattgattcctcgccgccgcataggagaacagaacaac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55865655 |
caaattgattcctcgccgccgcataggagaacagaacaac |
55865616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 5520875 - 5520811
Alignment:
| Q |
47 |
gtgagacggtaattagtcccagcaaccacctgagattcaccgttgataactttctcgaacttcag |
111 |
Q |
| |
|
||||||||||| |||||||| ||||| || || |||||||| |||| || |||||||||||||| |
|
|
| T |
5520875 |
gtgagacggtagttagtccctgcaacaacttgtgattcacccttgacgaccttctcgaacttcag |
5520811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University