View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_1D_low_33 (Length: 237)
Name: NF7577_1D_low_33
Description: NF7577_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_1D_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 17759757 - 17759538
Alignment:
| Q |
15 |
gacatcattagggacaaggagagtagacaggattgcacaaacaagcataaattgaagttttaaagccatgtgagattttggctaagatgatcataggaaa |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17759757 |
gacatcatcagggacaaggagagtagacaggattgcacaaacaagcataaattaaaggtttaaagccatgtgagattttggctaagatgatcataggaaa |
17759658 |
T |
|
| Q |
115 |
cacagcaagatacaaaataatagattagaccattttttattcagggagatattgaacaggacacctgttcttgcttccagagaaac---agaagcatgag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17759657 |
cacagcaagatacaaaataatagattagacca---tttattcaaggagatattgaacaggacacctgttcttgcttccagagaaacagaagaagcatgag |
17759561 |
T |
|
| Q |
212 |
gttttgcggattcagcctccatg |
234 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
17759560 |
gttttgcagattcagcctccatg |
17759538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University