View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_1D_low_36 (Length: 230)
Name: NF7577_1D_low_36
Description: NF7577_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_1D_low_36 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 35072090 - 35071874
Alignment:
| Q |
14 |
tgaaagttgaggttgaagatggaagagtgcttcagataacaggagagaggagcatggagagacaagatacaaatgatggatgtcagcgtgttgagcgtag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072090 |
tgaaagttgaggttgaagatggaagagtgcttcagataacaggagagaggagcatggagagacaagatacaaatgatggatgtcagcgtgttgagcgtag |
35071991 |
T |
|
| Q |
114 |
tagtggtaaattcatgaggagttttactcttccagctaactgtaaattggatcaggttaaggcttctattgaagatggtgttcttactgttactgtccct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35071990 |
tagtggtaaattcatgaggagttttactcttccagctaactgtaaattggatcaggttaaggcttctattgaagatggtgttcttactgttactgtccct |
35071891 |
T |
|
| Q |
214 |
aaggaagaggttaccaa |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35071890 |
aaggaagaggttaccaa |
35071874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 34919170 - 34919235
Alignment:
| Q |
156 |
taaattggatcaggttaaggcttctattgaagatggtgttcttactgttactgtccctaaggaaga |
221 |
Q |
| |
|
|||| ||||||||||||| ||| ||| || |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
34919170 |
taaaatggatcaggttaaagctggtatggagaatggggttcttactgttactgttcctaaggaaga |
34919235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University