View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_1D_low_37 (Length: 228)
Name: NF7577_1D_low_37
Description: NF7577_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_1D_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 42709190 - 42709373
Alignment:
| Q |
18 |
cctgtggctataaattccctaccagtgcaaattgagaggattacacaataggctatatcgaggaaggtgacgttccaacccaatttccagtgctgaatgt |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42709190 |
cctgtggctataaattccctaccagcacaaattgagaggattacacaataggctatagcgaggaaggtgacgttccaacccaatttccagtgctgaatgt |
42709289 |
T |
|
| Q |
118 |
cccttgctatggcgaaggcaacagctaaagactgaattgagcttaagaaacattggagagtcgtaaagattaactttgaagggt |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42709290 |
ccctttctatggcgaaggcaacagctaaagactgaattgagcttaataaacattggagagtcgtaaagattaactttgaagggt |
42709373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 50 - 205
Target Start/End: Complemental strand, 43623449 - 43623294
Alignment:
| Q |
50 |
tgagaggattacacaataggctatatcgaggaaggtgacgttccaacccaatttccagtgctgaatgtcccttgctatggcgaaggcaacagctaaagac |
149 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| | |||||||||||||||||||||| |||| |||||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
43623449 |
tgagaggtttacacaataggctatagcgaggaggctgacgttccaacccaatttccactgctcaatgtccctttctatggccaaggcaatagctaaagat |
43623350 |
T |
|
| Q |
150 |
tgaattgagcttaagaaacattggagagtcgtaaagattaactttgaagggtagtc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
43623349 |
tgaattgagcttaagaaacattggagagtcgtaaagctcaactttgaagggtagtc |
43623294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 178
Target Start/End: Complemental strand, 38765786 - 38765750
Alignment:
| Q |
142 |
ctaaagactgaattgagcttaagaaacattggagagt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38765786 |
ctaaagactgaattgagcttaagaaacattgaagagt |
38765750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University