View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_1D_low_38 (Length: 226)
Name: NF7577_1D_low_38
Description: NF7577_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_1D_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 220
Target Start/End: Complemental strand, 37492339 - 37492128
Alignment:
| Q |
9 |
gaaatggaatggattggatcagaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaagtaaaa |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492339 |
gaaatggaatggattggatcggaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaagtaaaa |
37492240 |
T |
 |
| Q |
109 |
caaccaaagaaatcaaagcatcattacaaaaataagagtagcatcattctaatttgaaattaaatgtaaacagaatgatcttaaccactatgcagtatgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37492239 |
caaccaaagaaatcaaagcatcattacaaaaataagagtagcatcattctgatttgaaattaaatgtaaacagaatgattttaaccactatgcagtatgc |
37492140 |
T |
 |
| Q |
209 |
acatacaccatg |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37492139 |
acatacaccatg |
37492128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University