View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_high_28 (Length: 204)
Name: NF7577_2D_high_28
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 32604702 - 32604516
Alignment:
| Q |
1 |
tcgtcacacattttgctaacatcattgtacgttcgaccttccattttctatcgtatgtgcaatctgagccatcttgttttttactcttattgttttcaac |
100 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604702 |
tcgtcgcacattttgctaacatcattgtgcgttcgaccttccattttctatggtatgtgcaacctgagccatcttgttttttactcttattgttttcaac |
32604603 |
T |
 |
| Q |
101 |
actatgaatagaaatctaaggctccatcccaaatcacatgaaagcttccaagctttctcttttctctcttttgctcgttgcacttct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604602 |
actatgaatagaaatctaaggctccatcccaaatcacatgaaagcttccaagctttctcttttctctcttttgctcgttgcacttct |
32604516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University