View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_32 (Length: 339)
Name: NF7577_2D_low_32
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 19 - 148
Target Start/End: Original strand, 1041900 - 1042029
Alignment:
| Q |
19 |
atgaataacatagcaaaatagatcaaaactgaaagcaaatttaaatgagattgatgtgcggttatgttgagaagagagatgtgaaacattgagagatcaa |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1041900 |
atgaataagatagcaaaatagatcaaaactgaaagcaaatttaaatgagattgatgtgcggttatgttgagaagagagatgtgaaacattgagagatcaa |
1041999 |
T |
 |
| Q |
119 |
atgcaaaaatcttatgtggttggattgtcg |
148 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
1042000 |
atgcaaaaatcttatgtggttggtttgtcg |
1042029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 198 - 315
Target Start/End: Original strand, 1042079 - 1042196
Alignment:
| Q |
198 |
cacaagatgggtgtcatgaccgtgataccaagttatgaaatatggcatcgatggattaacaggttataaaatagaacatgtagtagaaatgagaaaggtt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1042079 |
cacaagatgggtgtcatgaccgtgataccaagttatgaaatatggcatcgatggattaacaggttataaaatagaacatgtagtagaaatgagaaaggtt |
1042178 |
T |
 |
| Q |
298 |
atctttgaatgattaatc |
315 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1042179 |
atctttgaatgattaatc |
1042196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University