View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_33 (Length: 322)
Name: NF7577_2D_low_33
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 47438435 - 47438292
Alignment:
| Q |
1 |
cttcttttgcgatcttaataattcttattttcttcaattcgacatatatagatagactacttttcctacgtggaaacctataatgccatgaccatgaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47438435 |
cttcttttgcgatcttaataattcttattttcttcaatccgacatata--gatagactacttttcctacgtggaaacctataatgcc------atgaggc |
47438344 |
T |
|
| Q |
101 |
atatgtgtgacatcatggttatgactactaaaattttagtattaaatcccag |
152 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47438343 |
atatgtgtgacatcatggttatgactgctaaaattttagtattaaatcccag |
47438292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 161 - 229
Target Start/End: Complemental strand, 47438235 - 47438167
Alignment:
| Q |
161 |
tcatatttcaaaatttgttttagacctctaaattattattttcgcatattttcaatcttctttagtgtc |
229 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47438235 |
tcatatttcaaaatttgttttagatctttaaattattattttcgcatattgtcaatcttctttagtgtc |
47438167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University