View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_36 (Length: 318)
Name: NF7577_2D_low_36
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 20 - 313
Target Start/End: Complemental strand, 47788822 - 47788529
Alignment:
| Q |
20 |
aaaaagataaagaaaaggataaaaggtaggtagttacttcattaacatagggccagatcttggtaagatgagagttaagccaagttaatttttgtctatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47788822 |
aaaaagataaagaaaaggataaaaggtaggtagttacttcattaacatagggccagatcttggtaagatgagagttaagccaagttaatttttgtctatt |
47788723 |
T |
 |
| Q |
120 |
ggagaagacgacccaggaagggtagaactgagaaggtaaaagctttctagaatcttcgacggtcattcgagcaaaagcggcgatggtggtagcgagctgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47788722 |
ggagaagacgacccaggaagggtagaactgagaaggtaaaagctttctagaatcttcgacggtcattcgagcaaaagcggcgatggtggtagcgagctgg |
47788623 |
T |
 |
| Q |
220 |
gatcgacgggcggagcgggaattttcggagcggacaaaggcgataatgatggcgaggccgactattattccgaccaccactccgaacaccaaac |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
47788622 |
gatcgacgggcggagcgggaattttcggagcggacaaaggcgataatgatggcgagtccgactattattccgaccaccactccaaacacgaaac |
47788529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University