View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_38 (Length: 315)
Name: NF7577_2D_low_38
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 16 - 297
Target Start/End: Original strand, 44378686 - 44378967
Alignment:
| Q |
16 |
gtgtcaaactctgatggcgtggtgattcttgaagcattcatttgtgaactccgactgatattgttgaggtgagaaaagaacatggcctcagtaatgtgat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44378686 |
gtgtcaaactctgatggcgtggtgattcttgaagcattcatttgtgaactccgaccgatattgttgaggtgagaaaagaacatggcctcagtaatgtgat |
44378785 |
T |
|
| Q |
116 |
gagggtcatgtttgatattgcttccaatatcaaactcattttccaaatcatcaatcccatcctcttcttcgtcaccctcaactcttggactacctgattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44378786 |
gagggtcatgtttgatattgcttccaatatcaaactcattttccaaatcatcaatcccatcctcttcttcgtcaccctcaactcttggactacctgattg |
44378885 |
T |
|
| Q |
216 |
ttagaaaagcaaccctcattcaaaagcaaacagatatgaaaaatacaaacaaataacacgcgggatttgatcagggagttcg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44378886 |
ttagaaaagcaaccctcattcaaaagcaaacagatatgaaaaatacaaacaaataacacgcgggatttgatcagggagttcg |
44378967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 274
Target Start/End: Original strand, 3917806 - 3917847
Alignment:
| Q |
233 |
attcaaaagcaaacagatatgaaaaatacaaacaaataacac |
274 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
3917806 |
attcaaaagtaaacagatatgaaaagcacaaacaaataacac |
3917847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University