View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_40 (Length: 306)
Name: NF7577_2D_low_40
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 32725427 - 32725277
Alignment:
| Q |
1 |
tatagggttgaagaggtgggtgtgggtagtaataagttggtgttggattggaaatcaagacgtttgctttctgcttccctttggacttgttcttcttcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725427 |
tatagggttgaagaggtgggtgtgggtagtaataagttggtgttggattggaaatcaagacgtttgctttctgcttccctttggacttgttcttcttcag |
32725328 |
T |
|
| Q |
101 |
attctgatttataggatgctgattaattaagtgctaatctatactagctaa |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725327 |
attctgatttataggatgctgattaattaagtgctaatctatactagctaa |
32725277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 148 - 287
Target Start/End: Original strand, 32725511 - 32725650
Alignment:
| Q |
148 |
ctaaccactccccccatgaccttctctcctcttcaccacccgttctatatatccggcccaacgagcctgcaattctaggcccaaaaaataccctctccac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725511 |
ctaaccactccccccatgaccttctctcctcttcaccacccgttctatatatccggcccaacgagcctgcaattctaggcccaaaaaataccctctccac |
32725610 |
T |
|
| Q |
248 |
caaagtccgggcccggttctgcatcggaaaaccagcctcc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725611 |
caaagtccgggcccggttctgcatcggaaaaccagcctcc |
32725650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 31 - 90
Target Start/End: Complemental strand, 24256414 - 24256355
Alignment:
| Q |
31 |
aataagttggtgttggattggaaatcaagacgtttgctttctgcttccctttggacttgt |
90 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24256414 |
aataagttggtgttaggttggaaatcaagacgtttgctttctgcttctgtttggacttgt |
24256355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University