View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_44 (Length: 285)
Name: NF7577_2D_low_44
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_44 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 79 - 285
Target Start/End: Original strand, 41733513 - 41733719
Alignment:
| Q |
79 |
cggttcaaaaattgttgcaccaaaaatacaaaatttacttttannnnnnnaactaatatccttggaacaattgttagcacaaatcacaatccaattttga |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41733513 |
cggttcaaaaattgttgcaccaaaaatacaaaatttacttttatttttttaactaatatccttggaacaattgttagcacaaatcacaatccaattttga |
41733612 |
T |
 |
| Q |
179 |
ttactttttatttgtcgtttttaaaataagaaatagtattagccatttctttgtcaaaattatttattgcatagaagtaaattcttgaaatgatatcatg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
41733613 |
ttactttttatttgtcgtttttaaaataagaaatagtatcagccatttctttgtcaaaattatttattgcatagaagtaaattcttgaaatgaaataatg |
41733712 |
T |
 |
| Q |
279 |
aataatt |
285 |
Q |
| |
|
||||||| |
|
|
| T |
41733713 |
aataatt |
41733719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 41733366 - 41733417
Alignment:
| Q |
1 |
ttaaagaaaaatgcaagtgagtgtcttcttagagcattgattaagaaaataa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41733366 |
ttaaagaaaaatgcaagtgagtgtcttcttagagcattgattaagaaaataa |
41733417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University