View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_55 (Length: 268)
Name: NF7577_2D_low_55
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 20 - 257
Target Start/End: Original strand, 30876812 - 30877042
Alignment:
| Q |
20 |
ggattttagttgtggtgtatagataagttatatgtgttccctca-aaaaagaaaagat-aagttatatgtgttgtctccattaaataatgttcaaattac |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30876812 |
ggattttagttgcggtgtatagataagttatatgtgttccctcagaaaaaaaaaagattaagttatatgtgttgtctccattaaataatgttcaaattac |
30876911 |
T |
 |
| Q |
118 |
attatcttttcattta-ttttaaaaacatagattctcctctcataggatattaatatttcttgtactttaagttatatacattaataacttttttgataa |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30876912 |
attatcttttcatttatttttaaaaaca----------tgtcataggatattactatttcttgtactttaagttatatacattaataacttttttgataa |
30877001 |
T |
 |
| Q |
217 |
atttaaagtaatatatgatcacctctcttcacgactttcag |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877002 |
atttaaagtaatatatgatcacctctcttcacgactttcag |
30877042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University