View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_56 (Length: 256)
Name: NF7577_2D_low_56
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_56 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 256
Target Start/End: Original strand, 52712599 - 52712834
Alignment:
| Q |
21 |
ggggttggggttttggaattcccacaataactacggttttatctattgttgttctagctgccggtgttcggtattaccgtttccaaaaggcaatgggaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52712599 |
ggggttggggttttggaattcccacaataactacggttttatctatcgttgttctagctgccggtgttcggtattaccgtttccaaaagccaatgggaag |
52712698 |
T |
 |
| Q |
121 |
cccttttactaggtttcttcaggttattgtagcctccgtcaagaaacatcaaagaggagtctccgtagaaaatgagcctactctctacgaggttgagacc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712699 |
cccttttactaggtttcttcaggttattgtagcctccgtcaagaaacatcaaagaggagtctccgtagaaaatgagcctactctctacgaggttgagacc |
52712798 |
T |
 |
| Q |
221 |
acacactctgatattattggcgctcgcaagcttcct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712799 |
acacactctgatattattggcgctcgcaagcttcct |
52712834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 21 - 256
Target Start/End: Original strand, 52721420 - 52721655
Alignment:
| Q |
21 |
ggggttggggttttggaattcccacaataactacggttttatctattgttgttctagctgccggtgttcggtattaccgtttccaaaaggcaatgggaag |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||| ||| |||||||||| |||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
52721420 |
ggggttggggttttggaatacccacaataactatggttttatctatcgttcttctagctgctggtgttcggtattaccgttttcaaaagccaatgggaag |
52721519 |
T |
 |
| Q |
121 |
cccttttactaggtttcttcaggttattgtagcctccgtcaagaaacatcaaagaggagtctccgtagaaaatgagcctactctctacgaggttgagacc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
52721520 |
cccttttactaggtttcttcaggttattgtagcctccgtcaagaaacatcgaaaaggagtttccgtagaaaatgaacctactctctatgaggttgagacc |
52721619 |
T |
 |
| Q |
221 |
acacactctgatattattggcgctcgcaagcttcct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52721620 |
acacactctgatattattggcgctcgcaagcttcct |
52721655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 24 - 255
Target Start/End: Original strand, 52698783 - 52699014
Alignment:
| Q |
24 |
gttggggttttggaattcccacaataactacggttttatctattgttgttctagctgccggtgttcggtattaccgtttccaaaaggcaatgggaagccc |
123 |
Q |
| |
|
|||||||||||| | | ||||||||||||||| || ||||||| ||| | | || | ||| ||| |||||| ||||| ||||| ||||||||||||| |
|
|
| T |
52698783 |
gttggggttttgcattacccacaataactacgattatatctatcgttatcttggccgttggtattccgtattatcgttttcaaaaaccaatgggaagccc |
52698882 |
T |
 |
| Q |
124 |
ttttactaggtttcttcaggttattgtagcctccgtcaagaaacatcaaagaggagtctccgtagaaaatgagcctactctctacgaggttgagaccaca |
223 |
Q |
| |
|
|| |||||||||||||||||||||||||| || | |||||||||| | |||||||||| ||||||||||| || ||||||| |||||||| |||||| |
|
|
| T |
52698883 |
attcactaggtttcttcaggttattgtagcttctataaagaaacatcgaggaggagtctcagtagaaaatgaaactcctctctatgaggttgaaaccaca |
52698982 |
T |
 |
| Q |
224 |
cactctgatattattggcgctcgcaagcttcc |
255 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
52698983 |
tactctgatattattggtgctcgcaagcttcc |
52699014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University