View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_61 (Length: 232)
Name: NF7577_2D_low_61
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 41 - 215
Target Start/End: Original strand, 43621968 - 43622142
Alignment:
| Q |
41 |
aaagtgactagcagttctaactttatatcatccaagtgctatcnnnnnnnatcggtgaactcagctcatctattataagccattagtcgtgaaaataaag |
140 |
Q |
| |
|
||||||||||| | ||| ||||||||| || |||| ||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
43621968 |
aaagtgactagtaattccaactttataccacccaaatgctatctttttttatcggtgaactcagctcatctattataaaccattaatcgtgaaaataaag |
43622067 |
T |
|
| Q |
141 |
tttttcaatgattttgtcattggtgttaattataagtttcggtttctgtcattttgtgtaaaaatgtgcataata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43622068 |
tttttcaatgattttgtcattggtgttaattataagcttcggtttctgtcattttgtgtaaaaatgtgcataata |
43622142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 43621895 - 43621945
Alignment:
| Q |
1 |
taattctccctggctctaattatttaactttgtattttgtaaagtgactag |
51 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43621895 |
taattctccctggctctaagtatttaactttgtattttgtaaagtgactag |
43621945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University