View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_62 (Length: 224)
Name: NF7577_2D_low_62
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 91 - 203
Target Start/End: Original strand, 47788882 - 47788994
Alignment:
| Q |
91 |
ataggctgcttctgagcttattaagacatcggcggaaccgatccttgaagaatacagaccaatgattttatctgctctcaaattttccaagtttactctt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47788882 |
ataggctgcttctgagcttattaagacatcggcggaaccgatccttgaagaatacagaccaatgattttatctgctctcaaattttccaagtttactctt |
47788981 |
T |
|
| Q |
191 |
ggtactgttgcac |
203 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47788982 |
ggtactgttgcac |
47788994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University