View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7577_2D_low_64 (Length: 218)
Name: NF7577_2D_low_64
Description: NF7577_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7577_2D_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 6003209 - 6003017
Alignment:
| Q |
17 |
gtgttcattagtaaaacttccactactaatcaaggcccaagtattcccaacagtttgtttggtcattatcatctatctcactctctttttgcaacaaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6003209 |
gtgttcattagtaaaacttccactactaatcaaggcccaagtattcccaacagtttgtttggtcattatcatctatctcactctctttttgcaacaaatt |
6003110 |
T |
|
| Q |
117 |
agggatggtcaaataatgcaatcaagaaggataatgacgattaatcatgnnnnnnnattattagaaaatttaggttaagagagaccctctcat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6003109 |
agggatggtcaaataatgcaatcaagaaggataatgacgattaatcatgtttttttattattaaaaaatttaggttaagagagaccctctcat |
6003017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University