View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7579_low_3 (Length: 339)
Name: NF7579_low_3
Description: NF7579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7579_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 128 - 323
Target Start/End: Original strand, 25603763 - 25603958
Alignment:
| Q |
128 |
gatttggattttattttgaatcggtttggatttgaacatcctctgattttaataaggtagttgtcttagaagacgacaacaaaagtccacatatggatgg |
227 |
Q |
| |
|
||||||||||| ||||| ||||||||| |||||||||||||||| ||||||||||||| ||||||||| | ||| ||||||||| | | | ||||| | |
|
|
| T |
25603763 |
gatttggatttcattttaaatcggtttagatttgaacatcctctaattttaataaggttattgtcttagcatacggtaacaaaagtacgcgtctggatag |
25603862 |
T |
|
| Q |
228 |
gttcaattttgcattcttcaagagtcttttggaggtgatcaatgaagatataagggtagtgtttgatgannnnnnngtaaatgaaaaacttccaaa |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
25603863 |
gttcaattttgcattcttcaagagtcttttggaggtgatcaatgaagatataagggtaatgtttgatgaattttttgtaaatgaaaaacttccaaa |
25603958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 165
Target Start/End: Original strand, 12291514 - 12291543
Alignment:
| Q |
136 |
ttttattttgaatcggtttggatttgaaca |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12291514 |
ttttattttgaatcggtttggatttgaaca |
12291543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 118 - 165
Target Start/End: Complemental strand, 32906880 - 32906832
Alignment:
| Q |
118 |
tttttagatcgatttg-gattttattttgaatcggtttggatttgaaca |
165 |
Q |
| |
|
||||| |||||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
32906880 |
tttttggatcgatttgcggttttattttggatcggtttggatttgaaca |
32906832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 118 - 165
Target Start/End: Original strand, 42414678 - 42414726
Alignment:
| Q |
118 |
tttttagatcgatttg-gattttattttgaatcggtttggatttgaaca |
165 |
Q |
| |
|
|||||||||||||||| | ||||| |||| ||||||||||||||||||| |
|
|
| T |
42414678 |
tttttagatcgatttgcggttttagtttggatcggtttggatttgaaca |
42414726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 118 - 165
Target Start/End: Complemental strand, 14461693 - 14461645
Alignment:
| Q |
118 |
tttttagatcgatttg-gattttattttgaatcggtttggatttgaaca |
165 |
Q |
| |
|
||||||||||| |||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
14461693 |
tttttagatcggtttgcggttttattttggatcggtttggatttgaaca |
14461645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University