View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7580_high_25 (Length: 343)
Name: NF7580_high_25
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7580_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 201 - 329
Target Start/End: Complemental strand, 46796305 - 46796177
Alignment:
| Q |
201 |
gtatgtgtacttttgatcaattatatgatgtggtgatatacttgagctatattttcgtccgtctgccccaactcagattggtaacagtatagttacattt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46796305 |
gtatgtgtacttttgatcaattatatgatgtggtgatatacttgggctatattttcgtccgtctgccccaactcagattggtaacagtatagttacattt |
46796206 |
T |
 |
| Q |
301 |
cacaaaataaatgtagctatgtgcaaagt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46796205 |
cacaaaataaatgtagctatgtgcaaagt |
46796177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 46796505 - 46796344
Alignment:
| Q |
1 |
tcaatatggtggcagtcaaccaactacaatatcatttcaatttattaa-aaaattatatctcgatttgtttagccgttnnnnnnnncaaaattgttttcc |
99 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46796505 |
tcaacatggtggcagtcaaccaactacaatatcatttcaatttattaaaaaaattatatctcgatttgtttagccgttaaaaa----aaaattgttttcc |
46796410 |
T |
 |
| Q |
100 |
cattatatgattaaaaagtatgtgtgtcc---nnnnnnnaggggaagtatgtgtgtccttgtaccc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46796409 |
cattatatgattaaaaagtatgtgtgtccttttttttttaggggaagtatgtgtgtccttgtaccc |
46796344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University