View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7580_high_60 (Length: 220)

Name: NF7580_high_60
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7580_high_60
NF7580_high_60
[»] chr8 (1 HSPs)
chr8 (7-217)||(6493847-6494057)


Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 217
Target Start/End: Complemental strand, 6494057 - 6493847
Alignment:
7 agaatcttactttttacaccggatgcggttacctcggcggttcaatcgccggtgccggagttggacttgtcgaaggtatccgatcctttgaatcaaccga 106  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6494057 agaatcttactttttacaccggttgcggttacctcggcggttcaatcgccggtgccggagttggacttgtcgaaggtatccgatcctttgaatcaaccga 6493958  T
107 cacagcgaagcttagggggaatcggattttgaatgcgtctgggcattcgggtcggacttggggaaatagggttgggattattgggttgttgtatgctgga 206  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6493957 cacagcgaagcttagggtgaatcggattttgaatgcgtctgggcattcgggtcggacttggggaaatagggttgggattattgggttgttgtatgctgga 6493858  T
207 attgagagtgg 217  Q
    |||||||||||    
6493857 attgagagtgg 6493847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University