View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7580_high_60 (Length: 220)
Name: NF7580_high_60
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7580_high_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 217
Target Start/End: Complemental strand, 6494057 - 6493847
Alignment:
| Q |
7 |
agaatcttactttttacaccggatgcggttacctcggcggttcaatcgccggtgccggagttggacttgtcgaaggtatccgatcctttgaatcaaccga |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6494057 |
agaatcttactttttacaccggttgcggttacctcggcggttcaatcgccggtgccggagttggacttgtcgaaggtatccgatcctttgaatcaaccga |
6493958 |
T |
 |
| Q |
107 |
cacagcgaagcttagggggaatcggattttgaatgcgtctgggcattcgggtcggacttggggaaatagggttgggattattgggttgttgtatgctgga |
206 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6493957 |
cacagcgaagcttagggtgaatcggattttgaatgcgtctgggcattcgggtcggacttggggaaatagggttgggattattgggttgttgtatgctgga |
6493858 |
T |
 |
| Q |
207 |
attgagagtgg |
217 |
Q |
| |
|
||||||||||| |
|
|
| T |
6493857 |
attgagagtgg |
6493847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University