View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7580_low_30 (Length: 328)
Name: NF7580_low_30
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7580_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 26 - 314
Target Start/End: Original strand, 21873351 - 21873644
Alignment:
| Q |
26 |
tattgtcttatagggttgactcttcctccttggggattaattgaatcgagatgatttccttgttgactccatatacttctttttatcagttatgttgtat |
125 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21873351 |
tattgtcttataggggtgactcttcctccttggggattaattgaatcgagaggatttccttgttgactccatatacttctttttatcagttatgttgtat |
21873450 |
T |
 |
| Q |
126 |
cgtgtacatgagatttatagaaac-cccgtattttgacttgtaaactctccacggactttgaccgtttcattggtggatctttcaatgtatccacatagt |
224 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21873451 |
cgtgtacatgagatttatagaaacaccagtattttgacttgtaaactcttcacggacttcgaccgtttcattggtggatctttcaatgtatccacatagt |
21873550 |
T |
 |
| Q |
225 |
gtttccttttttccatggactata----cgagggagaccaatgatttgtgatacttcattgtgttgtcgttgtcatgatatgattgcaagaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21873551 |
gtttccttttttccatggactataataccgagggagaccaatgatctgtgatacttcattgtgttgtcgttgtaatgatatgattgcaagaaat |
21873644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University