View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7580_low_34 (Length: 292)
Name: NF7580_low_34
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7580_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 273
Target Start/End: Original strand, 38086475 - 38086740
Alignment:
| Q |
8 |
atgacatctacccaaaaaccttaaaacatgcattaggcagtgagtcttctgcgccatattcatataattgcattgctgttacaaccaacataacatgtct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
38086475 |
atgacatctacccaaaaaccttaaaacatgcattaggcagtgagtcttctgcgtcatattcatataattgcattgttgttacaaccaacataacatatct |
38086574 |
T |
 |
| Q |
108 |
tgtgactacactttaagcaaggttttgatacaagaatccaacactagaatctactctcgtcctctcaccccaagaactaataccacatattgtgaatccg |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38086575 |
tgtgactacactctaagcaaggttttgatacaagaatccaacactagaatctactctcatcctctcaccccaagaactaataccacatattgtgaatccg |
38086674 |
T |
 |
| Q |
208 |
cagagtattgggaatgactgtgagccaattgtctaggaccaacaaaagaggaagatatcacatctc |
273 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38086675 |
cagagtattgggaacgactgcgagccaattgtctaggaccaacaaaagaggaagacatcacatctc |
38086740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University