View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7580_low_42 (Length: 271)
Name: NF7580_low_42
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7580_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 20691381 - 20691621
Alignment:
| Q |
13 |
aatatttttgggagttaatcagttcagacaatgattgggcaaggttagttagatctagagttttcaagaatgaaaattgcatctcatatcacatatattc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20691381 |
aatatttttgggagttaatcagttcagacaatgattgggcaaggttagttagatctagagttttcaagaatgaaaattgcatctcatatcacatatattc |
20691480 |
T |
|
| Q |
113 |
tttattgtggagtagtgtgaagaatgaatatattcttgcaaaagaaaactcaatttgacaaattggagatggcaccagagtgaacttttggaatgacaca |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20691481 |
tttattgtggagcagtgtgaagaatgaatatattcttgcaaaagaaaactcaatttgacaaattggagatggcaccagagtgaacttttggaatgacaca |
20691580 |
T |
|
| Q |
213 |
tggtgtgagaaacccctcatccaacttctgaacctcaatca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20691581 |
tggtgtgagaaacccctcatccaacttctgaacctcaatca |
20691621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University