View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7580_low_46 (Length: 258)
Name: NF7580_low_46
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7580_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 65 - 212
Target Start/End: Complemental strand, 17570944 - 17570797
Alignment:
| Q |
65 |
tttattgtataaatttataggtattttaatagatagaagtttgttatatgattatatcttcttttaaagggacttgaaactttcttaaagagacccaaac |
164 |
Q |
| |
|
||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
17570944 |
tttattgtataaatttatatgcattttgatagatagaagtttgttatatgattatatcttcttttaaagggacttgaaactttcttaaatagacacaaac |
17570845 |
T |
 |
| Q |
165 |
ttaacaactcattattcttctgaagcaattcaaatagatggtacgcaa |
212 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17570844 |
ttaacaactcgttattcttctgaagcagttcaaatagatggtacgcaa |
17570797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University