View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7580_low_49 (Length: 247)
Name: NF7580_low_49
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7580_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 71 - 234
Target Start/End: Complemental strand, 11163247 - 11163086
Alignment:
| Q |
71 |
tatcttcaaacactgtagggtcatgattgtaaaaaagtggtgcttttagtttttacaaagaaaaaacaaggaaagtatcacgttgtgacaagctcacagt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
11163247 |
tatcttcaaacactgtagggtcatgattgtaaaaaagtgatgcttttagtttttacaaagaaaaaacaaggaaaggatcacgttgtgacaagct--cagt |
11163150 |
T |
 |
| Q |
171 |
gtatccacccaaagcatcgatgctagattccgttcaacatgaaagtgaaccatttttacttgat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11163149 |
gtatccacccaaagcatcgatgctagattccgttcaacatgaaagtgaaccatttttacttgat |
11163086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 11163593 - 11163522
Alignment:
| Q |
1 |
ttttgtttcaattggactattttacccttaggtttattcatgatttactcaaggtatggctgcgtctatata |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11163593 |
ttttgtttcaattggactattttacccttaggtttattcatgatttactcaaggtatggctgcgtctatata |
11163522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 11176326 - 11176264
Alignment:
| Q |
147 |
atcacgttgtgacaagctcacagtgta-tccacccaaagcatcgatgctagattccgttcaac |
208 |
Q |
| |
|
||||||| ||||||||| || ||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11176326 |
atcacgtcgtgacaagcctactgtgtaatccacccaaagcatcgatgctagattcggttcaac |
11176264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University