View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7580_low_62 (Length: 209)
Name: NF7580_low_62
Description: NF7580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7580_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 24 - 196
Target Start/End: Original strand, 33766670 - 33766842
Alignment:
| Q |
24 |
tgttcgatcaaatcgttgaagggacaacatggagcactgttgatacaacagaggactatgccaaaggttttagttcatattatgaggttgtggtaatgcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33766670 |
tgttcgatcaaatcgttgaagggacaacatggagcactgttgatacaacagaggactatgccaaaggtcttagttcatattatgaggttgtggtaatgcc |
33766769 |
T |
 |
| Q |
124 |
ccatgggaagaagttgagtgtttgtttgggtaggaatgaacatactggcagcttaagtcccttcatctctgct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33766770 |
ccatgggaagaagttgagtgtttgtttgggtaggaatgaacatactggcagcttaagtcccttcatctctgct |
33766842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University