View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7581_low_10 (Length: 262)
Name: NF7581_low_10
Description: NF7581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7581_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 42858119 - 42858372
Alignment:
| Q |
1 |
tcccataacctgctgcgtttcccagggtcttcaacacattcttctcgaacaatctcccaacccatttcttgtatcaaatcatgcatggatacaattgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42858119 |
tcccataacctgctgcgtttcccagggtcttcaacacattcttctcgaacaatctcccaacccatttcttgtatcaaatcatgcatggatacaattgatc |
42858218 |
T |
 |
| Q |
101 |
ttccagagcccttggcttcaattataagggctttatctttaaggacccttaatccgataattgttgagaaaccacaggcatcaagcagagctattatctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42858219 |
ttccagagcccttggcttcaattataagggctttatctttaaggactcttaatccgataattgttgagaaaccacaggcatcaagcagagctattatctg |
42858318 |
T |
 |
| Q |
201 |
ttgcacttcatatcccttcaaaagacatgcaatatacaaaaatatgttcttctc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42858319 |
ttgcacttcatatcccttcaaaagacatgcaatatacaaaaatatgttcttctc |
42858372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 86
Target Start/End: Original strand, 23404914 - 23404952
Alignment:
| Q |
48 |
aacaatctcccaacccatttcttgtatcaaatcatgcat |
86 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
23404914 |
aacaatctcccatcccatttcttgtaacaaatcatgcat |
23404952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University