View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7581_low_6 (Length: 341)
Name: NF7581_low_6
Description: NF7581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7581_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 38420662 - 38420335
Alignment:
| Q |
1 |
ccttcaacacacaacttcttctctgcacatcaccatcacttcttagctatgtaagtattctaatcgatagctttcattcattgcaacttttt-cttaatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38420662 |
ccttcaacacacaacttcttctctgcacatcaccatcacttcttagctatgtaagtattctaatcgatagctttcattcattgcaacttttttcttaatt |
38420563 |
T |
|
| Q |
100 |
attatactagactagtatggccttttgaccatatactatatttataccgtatacttctgccactaaaccataaaaaattgctgttctgtttggtttgcta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38420562 |
attatactagactagtatggccttttgaccatatactatatttatactgtatacttctgccactaaaccataaaaaattgctgttctgtttggtttgcta |
38420463 |
T |
|
| Q |
200 |
gtttgtttaacaacctttccttcgagaagattttcagagtttatattgagtataactattcac-nnnnnnnnnnnnnnnncaattttccgatgataaaat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38420462 |
gtttgtttaacaacctttccttcgagaagattttcagagtttatattgagtataactattcactttttttcttcttttttcaattttccgatgataaaat |
38420363 |
T |
|
| Q |
299 |
cgccactctttcaccaatattagtgtat |
326 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
38420362 |
cgctactctttcaccaatattagtgtat |
38420335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University