View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7581_low_9 (Length: 273)
Name: NF7581_low_9
Description: NF7581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7581_low_9 |
 |  |
|
| [»] scaffold1099 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1099 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 261
Target Start/End: Complemental strand, 1808 - 1563
Alignment:
| Q |
16 |
caaatttaatttgttaaattcaattagatgatataaaaatagacaccaagtactatagaaagaacatgtctttgatgtttgaagagaattaccatgtgcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1808 |
caaatttaatttgttaaattcaattagatgatataaaaatagacactaagtactatagaaagaacatgtctttgatgtttgaagagaattaccgtgtgcg |
1709 |
T |
 |
| Q |
116 |
ttgtaaaaggaataaaaataaacaatgtaaagaagtttagaatcaataaatacacttctaggaatggctcctgcagttctgccgcttttcataaacagat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1708 |
ttgtaaaaggaataaaaataaacaatgtaaagaagtttagaaccaataaatacacttctaggaatggcttctgcagttctgccgcttttcataaacagat |
1609 |
T |
 |
| Q |
216 |
ttgagtcttataaaatgaatggggcaatttaaaaggtaattgttga |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608 |
ttgagtcttataaaatgaatggggcaatttaaaaggtaattgttga |
1563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University