View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7582_low_11 (Length: 266)
Name: NF7582_low_11
Description: NF7582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7582_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 16 - 124
Target Start/End: Original strand, 36838064 - 36838172
Alignment:
| Q |
16 |
cattccacctctcaattttgctatggttgataatggcattttccgttctggttttcctgaaccttccaacttctctttccttcaaacccttggtcttggc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36838064 |
cattccacctctcaattttgctatggttgataatggcattttccgttctggttttcctgaaccttccaacttctctttccttcaaacccttggtcttggc |
36838163 |
T |
 |
| Q |
116 |
tccatcatg |
124 |
Q |
| |
|
||||||||| |
|
|
| T |
36838164 |
tccatcatg |
36838172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 254
Target Start/End: Original strand, 36838265 - 36838302
Alignment:
| Q |
217 |
aactacccatttgatgatttattagtaaattatatatt |
254 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36838265 |
aactacccatttgatgatttatcagtaaattatatatt |
36838302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University