View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7582_low_13 (Length: 236)
Name: NF7582_low_13
Description: NF7582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7582_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 36816376 - 36816579
Alignment:
| Q |
17 |
gaacaattaaatcaaatgttaacaagtcttttataaggctgagaaaatcttgaatttagtgataaccactttaaacctcttactcataatatgatattga |
116 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36816376 |
gaacaattaaatcaaatgttaacaaatcctttataaggctgagaaaatcttgaatttagtgataaccactttaaacctcttactcataatatgatactgg |
36816475 |
T |
|
| Q |
117 |
taactcttaaacatttcatcaaactcttaatctacctttattatttact-aaaactaatatttctttgatcggcacaactttaaatctaaatactaacca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36816476 |
taactcttaaacatttcatcaaactcttaatctacctttattatttactaaaaactaatatttctttgatcggcacaactttaaatctaaatactaacca |
36816575 |
T |
|
| Q |
216 |
gagt |
219 |
Q |
| |
|
|||| |
|
|
| T |
36816576 |
gagt |
36816579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 25101238 - 25101291
Alignment:
| Q |
32 |
atgttaacaagtcttttataaggctgagaaaatcttgaatttagtgataaccac |
85 |
Q |
| |
|
||||| ||||||||||| ||||||||| | ||| |||||||| ||||||||||| |
|
|
| T |
25101238 |
atgttgacaagtcttttgtaaggctgaaagaatgttgaatttggtgataaccac |
25101291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University