View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7582_low_3 (Length: 491)

Name: NF7582_low_3
Description: NF7582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7582_low_3
NF7582_low_3
[»] chr2 (184 HSPs)
chr2 (5-475)||(32475730-32476204)
chr2 (361-462)||(29859776-29859878)
chr2 (362-459)||(2481464-2481562)
chr2 (362-423)||(4423890-4423951)
chr2 (365-422)||(24358890-24358947)
chr2 (365-417)||(4042608-4042660)
chr2 (366-462)||(11788321-11788417)
chr2 (363-462)||(15842727-15842827)
chr2 (369-461)||(29182348-29182440)
chr2 (366-462)||(37910755-37910851)
chr2 (364-423)||(16522988-16523047)
chr2 (366-464)||(16523227-16523326)
chr2 (365-423)||(8046327-8046385)
chr2 (365-462)||(14003646-14003744)
chr2 (365-462)||(25705083-25705181)
chr2 (361-462)||(33575746-33575848)
chr2 (366-462)||(1138263-1138360)
chr2 (366-462)||(13215059-13215156)
chr2 (366-462)||(24358615-24358712)
chr2 (362-423)||(33732857-33732918)
chr2 (368-417)||(42696153-42696202)
chr2 (367-462)||(20131585-20131681)
chr2 (361-417)||(22881607-22881663)
chr2 (366-422)||(25705394-25705450)
chr2 (367-423)||(40124966-40125022)
chr2 (367-422)||(4794130-4794185)
chr2 (367-422)||(5334751-5334806)
chr2 (367-422)||(5334985-5335040)
chr2 (368-423)||(10374775-10374830)
chr2 (362-417)||(17541726-17541781)
chr2 (364-423)||(18113086-18113145)
chr2 (364-423)||(36815779-36815838)
chr2 (365-423)||(4424129-4424187)
chr2 (360-422)||(14003402-14003464)
chr2 (364-422)||(16900151-16900209)
chr2 (364-422)||(16993542-16993600)
chr2 (365-423)||(24483835-24483893)
chr2 (364-422)||(37272047-37272105)
chr2 (361-462)||(40125193-40125295)
chr2 (369-422)||(146328-146381)
chr2 (365-422)||(19184096-19184153)
chr2 (361-422)||(20131311-20131372)
chr2 (365-422)||(26814174-26814231)
chr2 (365-422)||(30215420-30215477)
chr2 (360-417)||(31644834-31644891)
chr2 (365-422)||(33576062-33576119)
chr2 (365-422)||(37271737-37271794)
chr2 (365-422)||(38980198-38980255)
chr2 (362-423)||(43671929-43671990)
chr2 (366-423)||(44559061-44559118)
chr2 (366-423)||(44985928-44985985)
chr2 (367-462)||(146594-146690)
chr2 (367-423)||(9195054-9195110)
chr2 (370-422)||(15842464-15842516)
chr2 (366-422)||(16673716-16673772)
chr2 (363-423)||(20939269-20939329)
chr2 (370-422)||(29859490-29859542)
chr2 (367-423)||(34317798-34317854)
chr2 (363-415)||(37911072-37911124)
chr2 (366-422)||(41451836-41451892)
chr2 (362-422)||(44073752-44073812)
chr2 (364-423)||(38731826-38731885)
chr2 (366-417)||(43788857-43788908)
chr2 (369-423)||(1137983-1138037)
chr2 (365-423)||(11713789-11713847)
chr2 (365-423)||(17302087-17302145)
chr2 (367-417)||(23732039-23732089)
chr2 (367-417)||(27109073-27109123)
chr2 (365-423)||(31225713-31225771)
chr2 (365-423)||(42358697-42358755)
chr2 (367-417)||(42695868-42695918)
chr2 (365-462)||(43672222-43672320)
chr2 (369-423)||(44985623-44985677)
chr2 (366-423)||(9195150-9195207)
chr2 (366-423)||(10671629-10671686)
chr2 (365-422)||(16673409-16673466)
chr2 (365-422)||(17541380-17541437)
chr2 (365-422)||(19183780-19183837)
chr2 (366-423)||(26707872-26707929)
chr2 (370-423)||(35686282-35686335)
chr2 (366-423)||(40302283-40302340)
chr2 (366-423)||(43592045-43592102)
chr2 (366-423)||(43597153-43597210)
chr2 (361-422)||(43789137-43789198)
chr2 (365-417)||(3172018-3172070)
chr2 (365-417)||(3172482-3172534)
chr2 (367-423)||(3671136-3671192)
chr2 (372-460)||(4794380-4794468)
chr2 (367-423)||(8046592-8046648)
chr2 (367-423)||(11713485-11713541)
chr2 (365-413)||(23732282-23732330)
chr2 (361-417)||(23989832-23989888)
chr2 (365-413)||(27310874-27310922)
chr2 (365-413)||(29831812-29831860)
chr2 (367-415)||(31226029-31226077)
chr2 (367-415)||(33733193-33733241)
chr2 (367-423)||(36622250-36622306)
chr2 (371-423)||(36806840-36806892)
chr2 (365-417)||(37228731-37228783)
chr2 (367-423)||(41693947-41694003)
chr2 (369-417)||(44559359-44559407)
chr2 (365-417)||(44994011-44994063)
chr2 (368-423)||(3838208-3838263)
chr2 (367-422)||(5790558-5790613)
chr2 (367-422)||(5790844-5790899)
chr2 (360-423)||(7814681-7814744)
chr2 (366-417)||(10671891-10671942)
chr2 (367-422)||(26813866-26813921)
chr2 (366-417)||(27311019-27311070)
chr2 (368-423)||(29865222-29865277)
chr2 (366-462)||(30215774-30215872)
chr2 (366-417)||(31909429-31909479)
chr2 (366-417)||(38639411-38639462)
chr2 (367-417)||(4042840-4042890)
chr2 (365-423)||(10665238-10665296)
chr2 (367-417)||(34318033-34318083)
chr2 (369-423)||(36622528-36622582)
chr2 (365-423)||(40301973-40302031)
chr2 (361-423)||(40786454-40786516)
chr2 (365-423)||(41693672-41693730)
chr2 (370-423)||(1295491-1295544)
chr2 (369-422)||(1497890-1497943)
chr2 (365-422)||(2481191-2481248)
chr2 (366-423)||(3671002-3671059)
chr2 (365-422)||(7814244-7814301)
chr2 (366-423)||(13850521-13850578)
chr2 (366-423)||(20658060-20658117)
chr2 (366-423)||(29865455-29865512)
chr2 (367-416)||(34964110-34964159)
chr2 (366-462)||(36815487-36815584)
chr2 (362-423)||(43710652-43710713)
chr2 (367-423)||(1497610-1497666)
chr2 (363-423)||(2265341-2265401)
chr2 (367-415)||(10375021-10375069)
chr2 (367-423)||(12835325-12835381)
chr2 (366-414)||(13215318-13215366)
chr2 (363-423)||(16968548-16968608)
chr2 (367-415)||(18113406-18113454)
chr2 (366-414)||(20658362-20658410)
chr2 (366-422)||(26239105-26239161)
chr2 (367-423)||(38231431-38231487)
chr2 (363-423)||(43597443-43597503)
chr2 (370-417)||(3832587-3832634)
chr2 (370-417)||(13850834-13850881)
chr2 (370-417)||(17912761-17912808)
chr2 (368-423)||(24483401-24483456)
chr2 (364-423)||(25954370-25954429)
chr2 (362-417)||(38231771-38231826)
chr2 (365-423)||(3837931-3837989)
chr2 (365-423)||(5006605-5006663)
chr2 (365-423)||(26238811-26238869)
chr2 (365-423)||(31326196-31326254)
chr2 (365-423)||(35155563-35155621)
chr2 (365-462)||(39367664-39367762)
chr2 (369-423)||(41791020-41791074)
chr2 (367-413)||(41791266-41791312)
chr2 (368-417)||(4842865-4842914)
chr2 (366-423)||(10664983-10665040)
chr2 (362-423)||(19831503-19831564)
chr2 (366-415)||(32691312-32691361)
chr2 (364-417)||(45442646-45442699)
chr2 (369-421)||(25299987-25300038)
chr2 (365-417)||(25954113-25954165)
chr2 (367-423)||(31325920-31325976)
chr2 (373-417)||(35155298-35155342)
chr2 (370-418)||(37228991-37229039)
chr2 (370-417)||(17912452-17912499)
chr2 (370-417)||(23990146-23990193)
chr2 (363-417)||(14393079-14393132)
chr2 (369-423)||(25299747-25299801)
chr2 (380-414)||(29831885-29831919)
chr2 (362-415)||(13802481-13802534)
chr2 (386-415)||(16900100-16900129)
chr2 (386-415)||(16993491-16993520)
chr2 (386-423)||(22881912-22881949)
chr2 (368-417)||(34963796-34963845)
chr2 (366-415)||(45442315-45442364)
chr2 (370-414)||(5164438-5164482)
chr2 (367-423)||(11788052-11788108)
chr2 (366-398)||(12068373-12068405)
chr2 (387-423)||(26708148-26708184)
chr2 (365-417)||(29182166-29182218)
chr2 (304-344)||(32121874-32121914)
chr2 (367-422)||(38979889-38979945)
[»] chr8 (180 HSPs)
chr8 (365-459)||(11976371-11976465)
chr8 (362-423)||(4473988-4474049)
chr8 (365-423)||(10872913-10872971)
chr8 (365-462)||(14495067-14495164)
chr8 (363-462)||(28346390-28346490)
chr8 (364-462)||(7420494-7420593)
chr8 (367-462)||(7326324-7326421)
chr8 (365-462)||(8298879-8298977)
chr8 (361-462)||(10337113-10337215)
chr8 (361-423)||(24187563-24187625)
chr8 (364-422)||(34963297-34963355)
chr8 (365-462)||(37536084-37536182)
chr8 (366-462)||(4710124-4710221)
chr8 (366-462)||(6469279-6469376)
chr8 (366-462)||(9496340-9496437)
chr8 (366-423)||(25600229-25600286)
chr8 (367-423)||(10776443-10776499)
chr8 (366-422)||(11019802-11019858)
chr8 (363-423)||(14239024-14239084)
chr8 (366-462)||(27117752-27117848)
chr8 (362-462)||(28323844-28323944)
chr8 (366-422)||(28346703-28346759)
chr8 (366-422)||(32726216-32726272)
chr8 (367-462)||(34963568-34963664)
chr8 (367-422)||(2728542-2728597)
chr8 (359-422)||(9496668-9496731)
chr8 (364-423)||(10540726-10540785)
chr8 (363-422)||(11019516-11019575)
chr8 (364-423)||(16789072-16789131)
chr8 (367-422)||(35097637-35097692)
chr8 (363-417)||(2811731-2811785)
chr8 (361-423)||(16789313-16789375)
chr8 (365-423)||(20277690-20277748)
chr8 (365-423)||(20984144-20984202)
chr8 (365-423)||(21064317-21064375)
chr8 (364-422)||(22917561-22917619)
chr8 (365-423)||(25131109-25131167)
chr8 (365-423)||(27341535-27341593)
chr8 (365-462)||(32725905-32726003)
chr8 (365-423)||(40066495-40066553)
chr8 (365-423)||(43477161-43477219)
chr8 (366-462)||(3511905-3512002)
chr8 (365-414)||(3680754-3680803)
chr8 (365-422)||(7420228-7420285)
chr8 (366-423)||(13154885-13154942)
chr8 (368-417)||(24090438-24090487)
chr8 (366-462)||(35097327-35097424)
chr8 (366-462)||(35346902-35346999)
chr8 (365-417)||(1525807-1525859)
chr8 (366-422)||(3512211-3512267)
chr8 (367-423)||(4621298-4621354)
chr8 (367-423)||(7185948-7186004)
chr8 (366-422)||(7326085-7326141)
chr8 (367-423)||(8298587-8298643)
chr8 (366-422)||(10337394-10337450)
chr8 (367-419)||(13232510-13232562)
chr8 (367-423)||(14489017-14489073)
chr8 (362-422)||(16643989-16644049)
chr8 (366-422)||(19494118-19494174)
chr8 (366-422)||(19494358-19494414)
chr8 (365-417)||(32418316-32418368)
chr8 (367-423)||(42133098-42133154)
chr8 (367-422)||(1778564-1778619)
chr8 (366-417)||(5357422-5357473)
chr8 (367-422)||(10873225-10873280)
chr8 (366-417)||(20278007-20278058)
chr8 (366-417)||(21064634-21064685)
chr8 (367-422)||(35346629-35346684)
chr8 (367-422)||(37536364-37536419)
chr8 (365-462)||(2728230-2728328)
chr8 (369-415)||(13779151-13779197)
chr8 (365-423)||(14238749-14238807)
chr8 (365-423)||(20984454-20984512)
chr8 (359-417)||(24954960-24955018)
chr8 (365-423)||(29488054-29488112)
chr8 (364-422)||(38930299-38930357)
chr8 (365-423)||(44997929-44997987)
chr8 (365-422)||(4017245-4017302)
chr8 (370-423)||(13232201-13232254)
chr8 (370-462)||(13796500-13796593)
chr8 (366-423)||(17073806-17073863)
chr8 (366-423)||(17574407-17574464)
chr8 (367-456)||(25131358-25131447)
chr8 (365-414)||(27117929-27117978)
chr8 (365-454)||(28497253-28497342)
chr8 (370-423)||(28497563-28497616)
chr8 (366-423)||(29158353-29158410)
chr8 (366-423)||(29992244-29992301)
chr8 (366-423)||(33526356-33526413)
chr8 (366-422)||(1526117-1526173)
chr8 (365-417)||(1685112-1685164)
chr8 (367-415)||(4375692-4375740)
chr8 (366-422)||(4473703-4473759)
chr8 (361-417)||(6146510-6146566)
chr8 (365-417)||(7272418-7272470)
chr8 (367-423)||(7272695-7272751)
chr8 (370-422)||(11976681-11976733)
chr8 (368-416)||(13779483-13779531)
chr8 (365-417)||(14847823-14847875)
chr8 (366-422)||(16643660-16643716)
chr8 (363-423)||(28324125-28324185)
chr8 (365-417)||(31445413-31445465)
chr8 (366-422)||(35143789-35143845)
chr8 (367-423)||(40066764-40066820)
chr8 (367-423)||(40844156-40844212)
chr8 (367-415)||(42132864-42132912)
chr8 (372-423)||(3680532-3680583)
chr8 (368-415)||(4016906-4016953)
chr8 (368-423)||(6146893-6146948)
chr8 (366-417)||(8094791-8094842)
chr8 (370-417)||(9175321-9175368)
chr8 (366-417)||(10540448-10540499)
chr8 (366-417)||(18549200-18549251)
chr8 (366-417)||(33636321-33636372)
chr8 (364-415)||(38930616-38930667)
chr8 (363-417)||(1408303-1408357)
chr8 (363-417)||(2355883-2355937)
chr8 (365-423)||(9175010-9175068)
chr8 (369-423)||(18549517-18549571)
chr8 (365-415)||(21125717-21125767)
chr8 (365-423)||(22650462-22650520)
chr8 (367-421)||(23939547-23939601)
chr8 (365-423)||(25600541-25600599)
chr8 (361-423)||(25702506-25702568)
chr8 (367-417)||(29158619-29158669)
chr8 (367-417)||(42430070-42430120)
chr8 (367-417)||(44998213-44998263)
chr8 (368-417)||(5357713-5357762)
chr8 (369-462)||(10776150-10776243)
chr8 (366-462)||(13155155-13155252)
chr8 (364-417)||(14496813-14496866)
chr8 (365-462)||(23939816-23939912)
chr8 (365-422)||(24187842-24187899)
chr8 (372-417)||(24814710-24814755)
chr8 (366-423)||(24815012-24815069)
chr8 (366-415)||(35345569-35345618)
chr8 (366-423)||(40492959-40493016)
chr8 (366-422)||(8094478-8094534)
chr8 (367-415)||(10755480-10755528)
chr8 (365-417)||(14488714-14488766)
chr8 (365-417)||(29991913-29991965)
chr8 (361-413)||(30337171-30337223)
chr8 (370-461)||(33652193-33652285)
chr8 (367-422)||(1162909-1162964)
chr8 (363-417)||(14495340-14495394)
chr8 (366-417)||(28258191-28258242)
chr8 (367-462)||(32195280-32195375)
chr8 (368-415)||(36044744-36044791)
chr8 (365-459)||(42429756-42429850)
chr8 (367-417)||(15719656-15719706)
chr8 (365-423)||(26530666-26530724)
chr8 (367-417)||(33526052-33526102)
chr8 (365-423)||(40844479-40844537)
chr8 (369-423)||(43727097-43727151)
chr8 (366-423)||(28398979-28399036)
chr8 (367-412)||(40493112-40493157)
chr8 (367-423)||(1408005-1408061)
chr8 (367-403)||(30969681-30969717)
chr8 (366-414)||(35115592-35115640)
chr8 (370-417)||(2356198-2356245)
chr8 (366-417)||(4375961-4376011)
chr8 (368-423)||(15930933-15930988)
chr8 (366-417)||(27341257-27341308)
chr8 (368-423)||(30969399-30969454)
chr8 (367-417)||(1163224-1163274)
chr8 (367-409)||(9908918-9908960)
chr8 (366-408)||(25702768-25702810)
chr8 (367-417)||(29487750-29487800)
chr8 (361-423)||(32040069-32040131)
chr8 (366-423)||(6469611-6469668)
chr8 (368-417)||(7578478-7578527)
chr8 (366-423)||(19962994-19963051)
chr8 (366-423)||(21125965-21126022)
chr8 (365-398)||(22534750-22534783)
chr8 (393-422)||(24954697-24954726)
chr8 (379-415)||(1778881-1778917)
chr8 (366-398)||(22270942-22270974)
chr8 (367-403)||(28398756-28398792)
chr8 (386-414)||(42430013-42430041)
chr8 (369-417)||(43727384-43727431)
[»] chr5 (167 HSPs)
chr5 (361-462)||(28871900-28872000)
chr5 (365-462)||(26071521-26071618)
chr5 (362-422)||(40764410-40764470)
chr5 (363-422)||(1381556-1381615)
chr5 (363-422)||(5917405-5917464)
chr5 (365-459)||(19685287-19685382)
chr5 (367-462)||(29366854-29366949)
chr5 (365-462)||(1381245-1381343)
chr5 (361-423)||(5614474-5614536)
chr5 (365-459)||(21124911-21125005)
chr5 (366-459)||(24443651-24443745)
chr5 (365-423)||(38170512-38170570)
chr5 (365-462)||(40764684-40764782)
chr5 (365-422)||(35928062-35928119)
chr5 (366-422)||(1105093-1105149)
chr5 (366-422)||(19565776-19565832)
chr5 (365-417)||(20660946-20660998)
chr5 (366-462)||(30800756-30800851)
chr5 (367-462)||(35928362-35928458)
chr5 (360-423)||(45131-45194)
chr5 (367-422)||(6912497-6912552)
chr5 (360-423)||(29692737-29692800)
chr5 (365-423)||(2217492-2217550)
chr5 (363-417)||(4203452-4203506)
chr5 (361-423)||(5950170-5950232)
chr5 (365-423)||(7075570-7075628)
chr5 (365-462)||(19565465-19565563)
chr5 (365-462)||(20985993-20986091)
chr5 (364-422)||(24443377-24443435)
chr5 (365-423)||(28863508-28863566)
chr5 (364-422)||(29151796-29151854)
chr5 (364-422)||(29172831-29172889)
chr5 (364-422)||(29875397-29875455)
chr5 (365-423)||(36578027-36578085)
chr5 (366-459)||(37271358-37271452)
chr5 (366-423)||(1104857-1104914)
chr5 (368-417)||(2636943-2636992)
chr5 (362-423)||(4736486-4736547)
chr5 (366-462)||(5917125-5917222)
chr5 (365-462)||(16038375-16038472)
chr5 (365-422)||(18633597-18633654)
chr5 (361-422)||(29875670-29875731)
chr5 (366-423)||(30800493-30800550)
chr5 (365-422)||(35167110-35167167)
chr5 (365-422)||(35876686-35876743)
chr5 (366-462)||(35876956-35877053)
chr5 (366-415)||(40038493-40038542)
chr5 (362-423)||(42596448-42596509)
chr5 (365-417)||(10743722-10743774)
chr5 (365-417)||(18258477-18258529)
chr5 (366-422)||(19685016-19685072)
chr5 (366-454)||(20690732-20690820)
chr5 (370-422)||(20985728-20985780)
chr5 (365-417)||(28213371-28213423)
chr5 (367-423)||(28550827-28550883)
chr5 (367-423)||(28863782-28863838)
chr5 (367-423)||(30888160-30888216)
chr5 (369-421)||(35609583-35609635)
chr5 (367-423)||(40029441-40029497)
chr5 (366-417)||(2217804-2217855)
chr5 (362-417)||(13990845-13990900)
chr5 (366-417)||(18046298-18046349)
chr5 (370-461)||(28108069-28108159)
chr5 (369-423)||(6912801-6912855)
chr5 (364-422)||(15635652-15635710)
chr5 (364-422)||(18258159-18258217)
chr5 (365-423)||(26133357-26133415)
chr5 (368-422)||(29172524-29172578)
chr5 (362-416)||(35166906-35166960)
chr5 (365-423)||(38786157-38786215)
chr5 (365-423)||(40167784-40167842)
chr5 (366-423)||(5904007-5904064)
chr5 (365-422)||(10408926-10408983)
chr5 (366-423)||(10830528-10830585)
chr5 (366-423)||(11799402-11799459)
chr5 (367-459)||(20661218-20661311)
chr5 (366-423)||(23381949-23382006)
chr5 (366-415)||(25561951-25562000)
chr5 (366-423)||(25779106-25779163)
chr5 (362-423)||(26133178-26133239)
chr5 (366-423)||(36577721-36577778)
chr5 (365-422)||(37271651-37271708)
chr5 (366-462)||(38554750-38554844)
chr5 (365-417)||(293826-293878)
chr5 (367-423)||(1286682-1286738)
chr5 (367-415)||(6118451-6118499)
chr5 (361-417)||(10409276-10409332)
chr5 (366-458)||(12144906-12144998)
chr5 (367-415)||(18633913-18633961)
chr5 (365-417)||(27916714-27916766)
chr5 (367-423)||(33335970-33336026)
chr5 (361-417)||(34125301-34125357)
chr5 (367-423)||(35609303-35609359)
chr5 (367-462)||(36973614-36973710)
chr5 (367-462)||(40038762-40038858)
chr5 (364-423)||(18286685-18286744)
chr5 (367-422)||(25561705-25561760)
chr5 (364-423)||(34125576-34125635)
chr5 (366-417)||(39379560-39379611)
chr5 (365-423)||(1286989-1287047)
chr5 (367-417)||(2636669-2636719)
chr5 (365-415)||(9179872-9179922)
chr5 (365-423)||(18046036-18046094)
chr5 (361-423)||(20683741-20683803)
chr5 (367-417)||(23382247-23382297)
chr5 (366-412)||(31602142-31602188)
chr5 (364-422)||(38496727-38496785)
chr5 (367-417)||(42553642-42553692)
chr5 (366-423)||(4203714-4203771)
chr5 (366-423)||(10743998-10744055)
chr5 (365-422)||(11799127-11799184)
chr5 (366-423)||(24781988-24782045)
chr5 (366-415)||(31037693-31037742)
chr5 (362-415)||(40029136-40029189)
chr5 (370-423)||(42596761-42596814)
chr5 (366-422)||(3850544-3850600)
chr5 (367-423)||(5103945-5104001)
chr5 (365-417)||(5614164-5614216)
chr5 (365-417)||(9532485-9532537)
chr5 (361-417)||(14318039-14318095)
chr5 (369-417)||(16038690-16038738)
chr5 (367-423)||(21050857-21050913)
chr5 (365-417)||(29693040-29693092)
chr5 (366-454)||(32108807-32108895)
chr5 (371-423)||(32888691-32888743)
chr5 (361-417)||(36278075-36278131)
chr5 (367-419)||(36973353-36973405)
chr5 (367-419)||(38962806-38962858)
chr5 (370-422)||(39379242-39379294)
chr5 (367-414)||(3850299-3850346)
chr5 (367-422)||(29151516-29151571)
chr5 (366-417)||(38555034-38555084)
chr5 (367-417)||(2032890-2032940)
chr5 (367-417)||(15916286-15916336)
chr5 (365-407)||(17070533-17070575)
chr5 (363-413)||(20416356-20416406)
chr5 (369-415)||(38452348-38452394)
chr5 (367-421)||(42994068-42994122)
chr5 (370-415)||(45456-45501)
chr5 (366-423)||(9179592-9179649)
chr5 (369-414)||(12145136-12145181)
chr5 (361-422)||(15635370-15635431)
chr5 (366-423)||(26071290-26071347)
chr5 (370-423)||(28871640-28871693)
chr5 (366-423)||(40167952-40168009)
chr5 (366-423)||(42207241-42207298)
chr5 (369-417)||(16616370-16616418)
chr5 (369-417)||(20691046-20691094)
chr5 (366-422)||(35166103-35166159)
chr5 (365-413)||(38182041-38182089)
chr5 (365-413)||(38189042-38189090)
chr5 (365-413)||(38209267-38209315)
chr5 (365-413)||(38216267-38216315)
chr5 (363-423)||(42207517-42207576)
chr5 (5-68)||(26204180-26204243)
chr5 (368-423)||(29855614-29855669)
chr5 (362-417)||(31037390-31037445)
chr5 (368-417)||(9588561-9588611)
chr5 (366-416)||(17070814-17070864)
chr5 (380-414)||(28213446-28213480)
chr5 (366-423)||(3851273-3851330)
chr5 (366-411)||(4736204-4736249)
chr5 (380-417)||(31602221-31602258)
chr5 (366-410)||(7085477-7085520)
chr5 (366-417)||(10830846-10830898)
chr5 (367-423)||(21050575-21050631)
chr5 (369-417)||(27850324-27850372)
[»] chr7 (182 HSPs)
chr7 (365-462)||(1614808-1614906)
chr7 (365-462)||(9659593-9659691)
chr7 (364-423)||(45228862-45228921)
chr7 (365-423)||(3975547-3975605)
chr7 (361-462)||(5354762-5354864)
chr7 (366-460)||(12932690-12932784)
chr7 (365-462)||(44568594-44568692)
chr7 (366-423)||(22539929-22539986)
chr7 (361-422)||(23399606-23399667)
chr7 (365-422)||(25988694-25988751)
chr7 (366-462)||(29198566-29198663)
chr7 (366-422)||(8144603-8144659)
chr7 (367-423)||(16853533-16853589)
chr7 (366-422)||(23676397-23676453)
chr7 (366-422)||(26878016-26878072)
chr7 (370-454)||(44841359-44841443)
chr7 (363-462)||(46828940-46829040)
chr7 (366-422)||(48192433-48192489)
chr7 (366-417)||(3975788-3975839)
chr7 (364-423)||(13770025-13770084)
chr7 (365-463)||(28911812-28911908)
chr7 (364-462)||(41053839-41053938)
chr7 (365-462)||(5234108-5234206)
chr7 (365-462)||(8144293-8144391)
chr7 (365-423)||(12894346-12894404)
chr7 (365-423)||(19757746-19757804)
chr7 (365-462)||(25092452-25092550)
chr7 (364-422)||(26877675-26877733)
chr7 (361-462)||(27037587-27037689)
chr7 (365-423)||(27458397-27458455)
chr7 (364-461)||(30223700-30223798)
chr7 (365-415)||(34878077-34878127)
chr7 (361-423)||(35838281-35838343)
chr7 (365-423)||(37372848-37372906)
chr7 (361-423)||(41054180-41054242)
chr7 (365-462)||(48853974-48854072)
chr7 (365-422)||(5233806-5233863)
chr7 (365-422)||(6108332-6108389)
chr7 (366-423)||(17999665-17999722)
chr7 (365-422)||(23399921-23399978)
chr7 (365-422)||(25092158-25092215)
chr7 (370-419)||(25547256-25547305)
chr7 (366-462)||(25988384-25988481)
chr7 (366-423)||(35104239-35104296)
chr7 (366-423)||(35470224-35470281)
chr7 (366-423)||(35665876-35665933)
chr7 (364-417)||(35837921-35837974)
chr7 (365-422)||(44508999-44509056)
chr7 (365-422)||(48192255-48192312)
chr7 (366-422)||(1614558-1614614)
chr7 (367-419)||(19561154-19561206)
chr7 (366-461)||(28262712-28262808)
chr7 (367-462)||(35469880-35469976)
chr7 (361-417)||(46759652-46759708)
chr7 (367-423)||(46829256-46829312)
chr7 (365-417)||(48852442-48852494)
chr7 (367-422)||(1006835-1006890)
chr7 (368-466)||(6079810-6079906)
chr7 (367-414)||(6589021-6589068)
chr7 (366-417)||(38486740-38486791)
chr7 (366-417)||(39438740-39438791)
chr7 (367-422)||(44508720-44508775)
chr7 (365-423)||(2945789-2945847)
chr7 (365-423)||(6509206-6509264)
chr7 (365-423)||(6509414-6509472)
chr7 (367-417)||(7431951-7432001)
chr7 (365-415)||(8555751-8555801)
chr7 (361-423)||(11767219-11767281)
chr7 (365-423)||(16940760-16940818)
chr7 (361-423)||(35210176-35210238)
chr7 (365-423)||(44344733-44344791)
chr7 (361-423)||(44402954-44403016)
chr7 (364-422)||(44568323-44568381)
chr7 (365-423)||(45073585-45073643)
chr7 (366-423)||(3807863-3807920)
chr7 (370-423)||(16940996-16941049)
chr7 (5-110)||(18044460-18044565)
chr7 (366-423)||(20388273-20388330)
chr7 (366-423)||(28911576-28911633)
chr7 (365-422)||(30223459-30223516)
chr7 (366-462)||(35015124-35015221)
chr7 (365-422)||(39438974-39439031)
chr7 (366-423)||(39832905-39832962)
chr7 (366-419)||(45021804-45021857)
chr7 (365-417)||(6589224-6589276)
chr7 (369-417)||(6847069-6847117)
chr7 (366-422)||(9659354-9659410)
chr7 (367-423)||(10358312-10358368)
chr7 (370-414)||(11766920-11766964)
chr7 (365-417)||(14543708-14543760)
chr7 (367-423)||(17999465-17999521)
chr7 (367-423)||(19561394-19561450)
chr7 (365-417)||(21223698-21223750)
chr7 (366-462)||(21554658-21554754)
chr7 (370-422)||(23676135-23676187)
chr7 (366-422)||(29198302-29198358)
chr7 (367-423)||(35210459-35210515)
chr7 (367-423)||(39833180-39833236)
chr7 (367-423)||(46759886-46759942)
chr7 (367-419)||(48359023-48359075)
chr7 (376-423)||(1271543-1271590)
chr7 (370-417)||(5355067-5355114)
chr7 (366-417)||(18022654-18022705)
chr7 (366-417)||(23816669-23816720)
chr7 (365-416)||(38186364-38186415)
chr7 (364-462)||(39520634-39520733)
chr7 (365-423)||(1559649-1559707)
chr7 (367-417)||(13769774-13769824)
chr7 (363-413)||(31310633-31310683)
chr7 (369-423)||(32189334-32189388)
chr7 (365-423)||(39520396-39520454)
chr7 (365-423)||(44958450-44958508)
chr7 (361-422)||(45021488-45021550)
chr7 (361-415)||(45073308-45073362)
chr7 (365-415)||(46648667-46648717)
chr7 (366-423)||(10358000-10358057)
chr7 (365-422)||(14738949-14739006)
chr7 (368-421)||(18022368-18022421)
chr7 (362-423)||(20388619-20388680)
chr7 (365-422)||(30352558-30352615)
chr7 (365-422)||(35104076-35104133)
chr7 (361-417)||(38186710-38186767)
chr7 (366-423)||(39719586-39719643)
chr7 (363-415)||(1559339-1559391)
chr7 (367-423)||(1974009-1974065)
chr7 (367-415)||(6911199-6911247)
chr7 (361-417)||(21223399-21223455)
chr7 (367-423)||(25547434-25547490)
chr7 (367-415)||(31732101-31732149)
chr7 (371-423)||(37372441-37372493)
chr7 (367-423)||(41364884-41364940)
chr7 (366-422)||(45228614-45228670)
chr7 (365-417)||(46304084-46304136)
chr7 (370-417)||(7432202-7432249)
chr7 (366-417)||(19783814-19783865)
chr7 (366-417)||(20355407-20355458)
chr7 (367-462)||(28528905-28529000)
chr7 (367-422)||(30352849-30352904)
chr7 (366-417)||(30709594-30709645)
chr7 (365-416)||(31732402-31732453)
chr7 (370-417)||(34877777-34877824)
chr7 (368-423)||(37527366-37527421)
chr7 (366-421)||(38486477-38486532)
chr7 (368-423)||(41365158-41365213)
chr7 (367-417)||(1007179-1007229)
chr7 (365-423)||(5308631-5308688)
chr7 (371-417)||(6954862-6954908)
chr7 (369-423)||(17854151-17854205)
chr7 (367-417)||(21554393-21554443)
chr7 (365-423)||(23816978-23817036)
chr7 (367-417)||(24717482-24717532)
chr7 (369-423)||(28263015-28263069)
chr7 (363-417)||(30709321-30709375)
chr7 (365-462)||(31503418-31503516)
chr7 (365-415)||(36684533-36684583)
chr7 (367-417)||(39719353-39719403)
chr7 (367-417)||(44403199-44403249)
chr7 (366-423)||(6892204-6892261)
chr7 (366-423)||(19465925-19465981)
chr7 (368-417)||(43300613-43300662)
chr7 (370-423)||(45671217-45671270)
chr7 (367-423)||(5308323-5308379)
chr7 (370-414)||(28529162-28529206)
chr7 (366-462)||(31310364-31310460)
chr7 (367-415)||(32189076-32189124)
chr7 (361-417)||(37953001-37953057)
chr7 (367-423)||(46304328-46304384)
chr7 (368-415)||(18311581-18311628)
chr7 (367-418)||(19005598-19005649)
chr7 (370-417)||(31503733-31503780)
chr7 (380-423)||(41054120-41054163)
chr7 (365-423)||(489016-489074)
chr7 (432-462)||(6911149-6911179)
chr7 (393-423)||(22540235-22540265)
chr7 (361-419)||(24954098-24954156)
chr7 (365-399)||(41693643-41693677)
chr7 (370-408)||(44841673-44841711)
chr7 (380-417)||(3808069-3808106)
chr7 (386-415)||(12894060-12894089)
chr7 (386-423)||(19758003-19758040)
chr7 (369-417)||(18311890-18311938)
chr7 (369-417)||(21488335-21488383)
[»] chr6 (146 HSPs)
chr6 (365-423)||(12299084-12299142)
chr6 (366-462)||(19321036-19321132)
chr6 (366-422)||(20467663-20467719)
chr6 (366-459)||(3968916-3969010)
chr6 (366-423)||(1007453-1007510)
chr6 (366-423)||(3414386-3414443)
chr6 (366-462)||(21993786-21993883)
chr6 (366-462)||(22543353-22543450)
chr6 (365-454)||(25136992-25137081)
chr6 (366-423)||(25137301-25137358)
chr6 (366-422)||(12419883-12419939)
chr6 (365-462)||(17765007-17765106)
chr6 (366-422)||(21994348-21994404)
chr6 (366-422)||(32885672-32885728)
chr6 (363-422)||(6412524-6412583)
chr6 (366-417)||(12419707-12419758)
chr6 (363-422)||(24274076-24274135)
chr6 (361-423)||(1007118-1007180)
chr6 (363-417)||(13268105-13268159)
chr6 (365-423)||(19690391-19690449)
chr6 (365-462)||(21385488-21385586)
chr6 (364-417)||(3276304-3276357)
chr6 (365-422)||(3968643-3968700)
chr6 (366-462)||(6412217-6412314)
chr6 (366-423)||(10910908-10910965)
chr6 (364-417)||(12757607-12757660)
chr6 (365-422)||(15076149-15076206)
chr6 (366-423)||(21147403-21147460)
chr6 (365-422)||(21385249-21385306)
chr6 (365-414)||(23502235-23502284)
chr6 (365-422)||(24273826-24273883)
chr6 (365-422)||(33801688-33801745)
chr6 (362-423)||(34582524-34582585)
chr6 (366-418)||(777991-778043)
chr6 (366-422)||(7156105-7156161)
chr6 (367-423)||(15962333-15962389)
chr6 (366-422)||(22543663-22543719)
chr6 (366-417)||(1214946-1214997)
chr6 (366-417)||(8170101-8170152)
chr6 (364-423)||(14656204-14656263)
chr6 (367-422)||(31198615-31198670)
chr6 (367-417)||(494405-494455)
chr6 (369-423)||(13617531-13617585)
chr6 (365-423)||(21995062-21995120)
chr6 (361-415)||(23502492-23502546)
chr6 (367-417)||(24901239-24901289)
chr6 (365-415)||(26375691-26375741)
chr6 (365-423)||(30928679-30928737)
chr6 (368-422)||(31166871-31166925)
chr6 (361-423)||(34990259-34990321)
chr6 (366-423)||(318041-318098)
chr6 (365-422)||(3414697-3414754)
chr6 (369-462)||(5286856-5286949)
chr6 (365-462)||(6468308-6468405)
chr6 (365-422)||(7155795-7155852)
chr6 (365-422)||(8681061-8681118)
chr6 (366-423)||(18024319-18024376)
chr6 (362-423)||(19267560-19267621)
chr6 (365-422)||(20467349-20467406)
chr6 (365-422)||(22822596-22822653)
chr6 (366-423)||(25431798-25431855)
chr6 (370-423)||(26375989-26376042)
chr6 (366-423)||(34582836-34582893)
chr6 (366-422)||(1890397-1890453)
chr6 (365-417)||(3356140-3356192)
chr6 (366-422)||(8680774-8680830)
chr6 (366-422)||(14655378-14655434)
chr6 (366-422)||(15962026-15962082)
chr6 (366-422)||(19129335-19129391)
chr6 (367-415)||(19296359-19296407)
chr6 (365-417)||(22792849-22792901)
chr6 (367-423)||(30928988-30929044)
chr6 (371-422)||(543365-543416)
chr6 (366-417)||(2615871-2615922)
chr6 (370-417)||(3356448-3356495)
chr6 (363-462)||(11448533-11448632)
chr6 (368-423)||(14428651-14428706)
chr6 (368-423)||(23770162-23770217)
chr6 (368-423)||(30479366-30479421)
chr6 (365-423)||(2373177-2373235)
chr6 (365-423)||(11449113-11449171)
chr6 (361-423)||(12612303-12612365)
chr6 (365-423)||(13150694-13150752)
chr6 (367-417)||(15442937-15442987)
chr6 (367-417)||(17771911-17771961)
chr6 (365-423)||(33131794-33131852)
chr6 (365-414)||(2616193-2616242)
chr6 (365-414)||(6591113-6591162)
chr6 (370-423)||(7324136-7324189)
chr6 (370-423)||(12176587-12176640)
chr6 (370-423)||(18024014-18024067)
chr6 (366-423)||(19129464-19129521)
chr6 (366-423)||(25121440-25121497)
chr6 (365-417)||(9896587-9896639)
chr6 (367-423)||(10910629-10910685)
chr6 (367-419)||(11129491-11129543)
chr6 (379-423)||(13617760-13617804)
chr6 (367-423)||(21995369-21995425)
chr6 (365-417)||(22822305-22822357)
chr6 (366-422)||(24692924-24692980)
chr6 (367-423)||(31186535-31186591)
chr6 (366-422)||(33808619-33808675)
chr6 (361-416)||(317806-317861)
chr6 (368-415)||(494704-494751)
chr6 (366-417)||(6564894-6564944)
chr6 (370-417)||(12298825-12298872)
chr6 (366-417)||(15722850-15722901)
chr6 (366-417)||(25121183-25121233)
chr6 (364-423)||(25431573-25431632)
chr6 (367-422)||(31167145-31167200)
chr6 (369-423)||(9896280-9896334)
chr6 (361-423)||(14655897-14655959)
chr6 (365-423)||(17765319-17765377)
chr6 (365-423)||(19296106-19296164)
chr6 (369-415)||(19320769-19320815)
chr6 (366-408)||(23770398-23770440)
chr6 (365-422)||(777675-777732)
chr6 (364-417)||(1214693-1214746)
chr6 (366-423)||(1875501-1875558)
chr6 (365-422)||(1890057-1890114)
chr6 (369-418)||(6591391-6591440)
chr6 (370-423)||(10091039-10091092)
chr6 (366-419)||(11925981-11926034)
chr6 (364-417)||(14428900-14428953)
chr6 (366-423)||(15722609-15722666)
chr6 (368-417)||(23628799-23628848)
chr6 (368-417)||(34989962-34990011)
chr6 (366-417)||(6564580-6564632)
chr6 (361-420)||(15116667-15116724)
chr6 (361-417)||(30239287-30239343)
chr6 (365-417)||(31398491-31398543)
chr6 (364-403)||(15117004-15117043)
chr6 (368-423)||(31276284-31276339)
chr6 (367-417)||(11925739-11925789)
chr6 (365-423)||(19267856-19267914)
chr6 (371-409)||(19690717-19690755)
chr6 (366-452)||(24901469-24901555)
chr6 (366-412)||(30479062-30479108)
chr6 (366-415)||(543676-543725)
chr6 (365-423)||(7323862-7323924)
chr6 (367-420)||(12611995-12612048)
chr6 (380-417)||(19275186-19275223)
chr6 (370-414)||(31276105-31276149)
chr6 (434-462)||(33746933-33746961)
chr6 (366-398)||(34995113-34995145)
chr6 (366-398)||(34998169-34998201)
[»] chr4 (214 HSPs)
chr4 (365-462)||(13530617-13530715)
chr4 (365-462)||(24774043-24774141)
chr4 (361-462)||(25423918-25424020)
chr4 (365-462)||(43231293-43231391)
chr4 (366-462)||(32365093-32365189)
chr4 (360-462)||(23779129-23779232)
chr4 (367-462)||(53307973-53308068)
chr4 (365-423)||(2322376-2322434)
chr4 (365-462)||(29499180-29499278)
chr4 (365-462)||(30046696-30046794)
chr4 (365-462)||(30061037-30061135)
chr4 (361-462)||(35464012-35464114)
chr4 (365-423)||(45505838-45505896)
chr4 (366-462)||(13631227-13631324)
chr4 (366-462)||(14487801-14487898)
chr4 (366-423)||(23245539-23245596)
chr4 (365-422)||(31560329-31560386)
chr4 (362-423)||(31811920-31811981)
chr4 (365-462)||(44925483-44925580)
chr4 (366-462)||(53915951-53916048)
chr4 (361-417)||(18205150-18205206)
chr4 (366-422)||(26412189-26412245)
chr4 (366-462)||(29420442-29420538)
chr4 (367-423)||(41324834-41324890)
chr4 (367-423)||(46115414-46115470)
chr4 (367-423)||(46128548-46128604)
chr4 (367-422)||(23245231-23245286)
chr4 (367-422)||(35464327-35464382)
chr4 (367-422)||(42848336-42848391)
chr4 (364-423)||(52017502-52017561)
chr4 (364-423)||(52017814-52017873)
chr4 (364-423)||(54903419-54903478)
chr4 (361-423)||(2180214-2180276)
chr4 (365-423)||(5827917-5827975)
chr4 (365-423)||(13064409-13064467)
chr4 (364-422)||(13631544-13631602)
chr4 (365-423)||(16712635-16712693)
chr4 (365-419)||(23778962-23779016)
chr4 (365-423)||(25424256-25424314)
chr4 (365-423)||(26314276-26314334)
chr4 (364-422)||(29499491-29499549)
chr4 (363-417)||(32208538-32208592)
chr4 (363-417)||(32208851-32208905)
chr4 (361-422)||(6827819-6827880)
chr4 (365-422)||(14791751-14791808)
chr4 (365-462)||(29463818-29463915)
chr4 (361-462)||(36701994-36702095)
chr4 (365-422)||(41345851-41345908)
chr4 (365-422)||(43231086-43231143)
chr4 (362-423)||(45505595-45505656)
chr4 (366-414)||(4211560-4211608)
chr4 (367-423)||(13073759-13073815)
chr4 (364-464)||(20144634-20144734)
chr4 (367-462)||(31560599-31560695)
chr4 (367-462)||(35415537-35415633)
chr4 (366-422)||(35763646-35763702)
chr4 (362-414)||(46292387-46292439)
chr4 (366-422)||(47023050-47023106)
chr4 (363-462)||(50753918-50754018)
chr4 (367-423)||(53717118-53717174)
chr4 (366-422)||(53915682-53915738)
chr4 (368-423)||(2322094-2322149)
chr4 (368-423)||(6353582-6353637)
chr4 (366-417)||(13074075-13074126)
chr4 (366-417)||(20291985-20292036)
chr4 (362-417)||(22099538-22099593)
chr4 (367-422)||(26412529-26412584)
chr4 (368-423)||(51763146-51763201)
chr4 (365-423)||(2034799-2034857)
chr4 (365-415)||(8904884-8904934)
chr4 (361-423)||(13064153-13064215)
chr4 (369-423)||(18205467-18205521)
chr4 (369-462)||(19903559-19903653)
chr4 (363-417)||(22099862-22099916)
chr4 (365-423)||(31812157-31812215)
chr4 (365-423)||(32365427-32365485)
chr4 (365-423)||(35119290-35119348)
chr4 (365-423)||(36054094-36054152)
chr4 (365-423)||(38054544-38054602)
chr4 (365-423)||(42848025-42848083)
chr4 (361-423)||(45593530-45593592)
chr4 (365-423)||(55072387-55072445)
chr4 (364-417)||(6827543-6827596)
chr4 (366-423)||(11693065-11693122)
chr4 (366-423)||(12152437-12152494)
chr4 (366-423)||(12791918-12791975)
chr4 (366-423)||(13479555-13479612)
chr4 (366-423)||(14488131-14488188)
chr4 (366-423)||(42823775-42823832)
chr4 (364-417)||(51545626-51545679)
chr4 (370-423)||(51545913-51545966)
chr4 (362-415)||(52543417-52543470)
chr4 (366-422)||(123533-123589)
chr4 (365-417)||(5052534-5052586)
chr4 (367-423)||(5827655-5827711)
chr4 (363-423)||(8760600-8760660)
chr4 (198-255)||(9075166-9075225)
chr4 (366-422)||(9289265-9289321)
chr4 (366-462)||(9289544-9289640)
chr4 (366-422)||(13530378-13530434)
chr4 (367-423)||(13764613-13764669)
chr4 (370-422)||(15555506-15555558)
chr4 (369-417)||(16712331-16712379)
chr4 (367-423)||(19321803-19321859)
chr4 (365-417)||(24474913-24474965)
chr4 (367-423)||(26313988-26314044)
chr4 (367-423)||(27008084-27008140)
chr4 (359-415)||(28449166-28449222)
chr4 (365-417)||(28809130-28809182)
chr4 (365-417)||(29380860-29380912)
chr4 (370-422)||(30060772-30060824)
chr4 (365-417)||(34361801-34361853)
chr4 (370-422)||(41619902-41619954)
chr4 (366-422)||(46088005-46088061)
chr4 (365-417)||(46292601-46292653)
chr4 (365-417)||(51708977-51709029)
chr4 (365-417)||(54208775-54208827)
chr4 (372-423)||(2034544-2034595)
chr4 (364-423)||(9445946-9446005)
chr4 (368-423)||(11285504-11285559)
chr4 (370-417)||(14791502-14791549)
chr4 (367-422)||(29463610-29463665)
chr4 (368-423)||(36050289-36050344)
chr4 (368-423)||(37557139-37557194)
chr4 (368-423)||(44925789-44925844)
chr4 (364-462)||(47022737-47022836)
chr4 (372-423)||(47532616-47532667)
chr4 (367-422)||(50714240-50714295)
chr4 (367-422)||(50714510-50714565)
chr4 (366-417)||(51708692-51708743)
chr4 (365-423)||(8760725-8760783)
chr4 (365-423)||(18136057-18136115)
chr4 (370-416)||(20144423-20144469)
chr4 (364-422)||(27427869-27427926)
chr4 (365-423)||(31182448-31182506)
chr4 (364-422)||(41620201-41620259)
chr4 (363-417)||(45474546-45474600)
chr4 (365-423)||(49123265-49123323)
chr4 (365-462)||(51762868-51762966)
chr4 (365-423)||(52442036-52442094)
chr4 (365-423)||(54903109-54903167)
chr4 (366-423)||(5882551-5882607)
chr4 (366-423)||(12152153-12152210)
chr4 (364-417)||(13764757-13764810)
chr4 (360-417)||(14594199-14594256)
chr4 (366-423)||(19903260-19903317)
chr4 (366-462)||(35763859-35763956)
chr4 (365-422)||(46115724-46115781)
chr4 (365-422)||(46128858-46128915)
chr4 (368-417)||(47136121-47136170)
chr4 (366-415)||(51738136-51738185)
chr4 (366-423)||(52430044-52430101)
chr4 (366-423)||(52441762-52441819)
chr4 (370-415)||(55072664-55072709)
chr4 (370-417)||(5202929-5202977)
chr4 (367-423)||(8191335-8191391)
chr4 (5-89)||(9075001-9075085)
chr4 (366-454)||(11692761-11692849)
chr4 (366-422)||(19321569-19321625)
chr4 (366-422)||(35415298-35415354)
chr4 (369-462)||(35420606-35420701)
chr4 (367-423)||(43368721-43368777)
chr4 (366-414)||(51738364-51738412)
chr4 (367-423)||(55482412-55482468)
chr4 (368-415)||(13479273-13479320)
chr4 (366-417)||(22584286-22584337)
chr4 (367-422)||(25358485-25358540)
chr4 (372-423)||(27008350-27008401)
chr4 (366-417)||(28448833-28448884)
chr4 (366-413)||(35119565-35119612)
chr4 (368-423)||(36702307-36702362)
chr4 (366-417)||(41346168-41346219)
chr4 (362-417)||(41921034-41921089)
chr4 (366-417)||(53716920-53716971)
chr4 (367-417)||(4279285-4279335)
chr4 (369-423)||(35420393-35420447)
chr4 (36-118)||(41967707-41967789)
chr4 (367-417)||(42824041-42824091)
chr4 (369-423)||(43368467-43368521)
chr4 (372-417)||(123848-123893)
chr4 (366-423)||(4279021-4279078)
chr4 (370-423)||(5797484-5797537)
chr4 (370-415)||(5797772-5797817)
chr4 (368-417)||(15555588-15555637)
chr4 (366-423)||(22584551-22584608)
chr4 (365-414)||(29380666-29380715)
chr4 (366-423)||(34355227-34355284)
chr4 (366-423)||(45593227-45593284)
chr4 (367-415)||(8905186-8905234)
chr4 (367-423)||(28809011-28809067)
chr4 (366-418)||(31370803-31370855)
chr4 (368-415)||(7639897-7639944)
chr4 (366-417)||(24474599-24474649)
chr4 (5-88)||(29551790-29551873)
chr4 (386-464)||(54208480-54208559)
chr4 (367-417)||(2180522-2180572)
chr4 (365-399)||(9836830-9836864)
chr4 (369-423)||(18831122-18831176)
chr4 (369-423)||(30564835-30564889)
chr4 (364-398)||(33137256-33137290)
chr4 (380-414)||(36050359-36050393)
chr4 (367-417)||(47274180-47274230)
chr4 (369-415)||(52543679-52543725)
chr4 (367-417)||(55805038-55805088)
chr4 (361-398)||(3879080-3879117)
chr4 (368-413)||(25358213-25358258)
chr4 (368-417)||(30890832-30890881)
chr4 (366-399)||(33134890-33134923)
chr4 (366-423)||(37556840-37556897)
chr4 (304-345)||(41508423-41508464)
chr4 (366-423)||(50754200-50754257)
chr4 (367-423)||(7642596-7642652)
chr4 (367-423)||(9446267-9446323)
chr4 (370-418)||(41920771-41920819)
[»] chr3 (239 HSPs)
chr3 (365-462)||(43441507-43441605)
chr3 (366-462)||(15979606-15979702)
chr3 (366-422)||(45002020-45002076)
chr3 (366-417)||(9603628-9603679)
chr3 (365-459)||(31480134-31480229)
chr3 (365-462)||(19844485-19844583)
chr3 (361-423)||(21159761-21159823)
chr3 (365-423)||(25615973-25616031)
chr3 (363-417)||(46751267-46751321)
chr3 (361-462)||(51550350-51550452)
chr3 (362-423)||(4513258-4513319)
chr3 (361-422)||(20612843-20612904)
chr3 (366-462)||(28552020-28552117)
chr3 (366-462)||(47336485-47336582)
chr3 (367-459)||(49323782-49323875)
chr3 (365-422)||(54608516-54608573)
chr3 (366-462)||(54608767-54608864)
chr3 (366-422)||(474353-474409)
chr3 (367-423)||(4034997-4035053)
chr3 (367-462)||(9261789-9261885)
chr3 (363-423)||(9597039-9597099)
chr3 (361-417)||(14772205-14772261)
chr3 (366-422)||(28552328-28552384)
chr3 (366-462)||(35407695-35407791)
chr3 (366-422)||(39288843-39288899)
chr3 (362-422)||(47336223-47336283)
chr3 (366-422)||(51550081-51550137)
chr3 (363-422)||(3387261-3387320)
chr3 (366-417)||(9262105-9262156)
chr3 (365-459)||(12741178-12741273)
chr3 (367-422)||(22008835-22008890)
chr3 (366-462)||(30128283-30128378)
chr3 (367-422)||(43441270-43441325)
chr3 (365-459)||(45002292-45002387)
chr3 (362-464)||(45313765-45313868)
chr3 (364-423)||(48924184-48924243)
chr3 (364-422)||(474041-474099)
chr3 (365-423)||(1721396-1721454)
chr3 (365-423)||(4950035-4950093)
chr3 (365-423)||(35565506-35565564)
chr3 (367-417)||(40370539-40370589)
chr3 (361-462)||(47005423-47005525)
chr3 (364-422)||(51834605-51834663)
chr3 (362-423)||(4513564-4513625)
chr3 (365-422)||(8940470-8940527)
chr3 (365-422)||(10977286-10977343)
chr3 (361-422)||(12740901-12740962)
chr3 (362-423)||(22008521-22008582)
chr3 (362-423)||(22016039-22016100)
chr3 (365-422)||(28427553-28427610)
chr3 (366-423)||(29955610-29955667)
chr3 (366-423)||(30004765-30004822)
chr3 (366-423)||(30106164-30106221)
chr3 (366-423)||(30130157-30130214)
chr3 (365-422)||(32119529-32119586)
chr3 (365-422)||(37507167-37507224)
chr3 (365-422)||(39437054-39437111)
chr3 (366-422)||(3152056-3152112)
chr3 (365-417)||(3387554-3387606)
chr3 (367-423)||(4034717-4034773)
chr3 (364-416)||(21553886-21553938)
chr3 (366-462)||(25609766-25609862)
chr3 (367-423)||(25710814-25710870)
chr3 (367-423)||(26090022-26090078)
chr3 (366-422)||(37506866-37506922)
chr3 (367-423)||(44802282-44802338)
chr3 (363-423)||(45320923-45320983)
chr3 (366-417)||(3151749-3151800)
chr3 (366-417)||(3830466-3830517)
chr3 (367-454)||(7957139-7957226)
chr3 (365-459)||(8940158-8940253)
chr3 (367-422)||(10976978-10977033)
chr3 (368-423)||(11463233-11463288)
chr3 (366-417)||(15286155-15286206)
chr3 (367-422)||(15979338-15979393)
chr3 (367-422)||(26089730-26089785)
chr3 (366-417)||(29490693-29490744)
chr3 (367-422)||(31480445-31480500)
chr3 (364-423)||(35569080-35569139)
chr3 (362-417)||(39288568-39288623)
chr3 (188-350)||(4159791-4159953)
chr3 (365-423)||(5345633-5345691)
chr3 (368-422)||(22156238-22156292)
chr3 (363-417)||(25610080-25610134)
chr3 (364-422)||(28942850-28942908)
chr3 (365-423)||(30268503-30268561)
chr3 (365-423)||(35177253-35177311)
chr3 (360-422)||(39436711-39436773)
chr3 (361-423)||(40545558-40545620)
chr3 (365-415)||(40979662-40979712)
chr3 (365-423)||(47005152-47005210)
chr3 (369-423)||(50196301-50196355)
chr3 (363-417)||(52342533-52342587)
chr3 (366-423)||(3830133-3830190)
chr3 (366-415)||(9603871-9603920)
chr3 (365-422)||(13584312-13584369)
chr3 (364-417)||(20611017-20611070)
chr3 (365-422)||(26799886-26799943)
chr3 (365-462)||(29678022-29678118)
chr3 (366-423)||(30034416-30034473)
chr3 (365-422)||(40169342-40169399)
chr3 (366-415)||(52342194-52342243)
chr3 (361-417)||(3361768-3361824)
chr3 (367-423)||(9863348-9863404)
chr3 (367-423)||(15016388-15016444)
chr3 (367-423)||(16123139-16123195)
chr3 (370-462)||(20907362-20907454)
chr3 (366-422)||(28452321-28452377)
chr3 (366-418)||(28942524-28942576)
chr3 (367-423)||(29445954-29446010)
chr3 (361-417)||(29525099-29525155)
chr3 (363-455)||(36673157-36673249)
chr3 (367-423)||(40370285-40370341)
chr3 (370-422)||(45005889-45005941)
chr3 (365-417)||(46186721-46186773)
chr3 (365-417)||(47114485-47114537)
chr3 (366-422)||(51500630-51500686)
chr3 (366-422)||(51834887-51834943)
chr3 (367-423)||(53701607-53701663)
chr3 (364-415)||(2486854-2486905)
chr3 (364-415)||(4814537-4814588)
chr3 (366-417)||(7588317-7588368)
chr3 (367-422)||(8510214-8510269)
chr3 (369-416)||(14633547-14633594)
chr3 (366-417)||(34238597-34238648)
chr3 (360-415)||(35936773-35936828)
chr3 (367-462)||(50009189-50009284)
chr3 (369-419)||(7518394-7518444)
chr3 (365-423)||(12673642-12673700)
chr3 (367-417)||(29686820-29686870)
chr3 (369-423)||(29955300-29955354)
chr3 (369-423)||(30004454-30004508)
chr3 (369-423)||(31869596-31869650)
chr3 (363-417)||(38232237-38232291)
chr3 (365-415)||(40277820-40277870)
chr3 (365-411)||(44802504-44802550)
chr3 (369-462)||(45006153-45006247)
chr3 (365-462)||(7518088-7518185)
chr3 (366-423)||(20404889-20404946)
chr3 (361-422)||(22155923-22155984)
chr3 (366-415)||(27681634-27681683)
chr3 (366-462)||(28452146-28452243)
chr3 (366-423)||(31869900-31869957)
chr3 (366-462)||(32119219-32119316)
chr3 (369-461)||(46724545-46724638)
chr3 (366-423)||(50196601-50196658)
chr3 (365-414)||(53113441-53113490)
chr3 (366-422)||(275443-275499)
chr3 (363-423)||(4322133-4322193)
chr3 (361-417)||(4814849-4814904)
chr3 (365-417)||(19656539-19656591)
chr3 (367-423)||(19844265-19844321)
chr3 (361-417)||(20757725-20757781)
chr3 (365-417)||(21159451-21159503)
chr3 (366-422)||(28427244-28427300)
chr3 (363-423)||(29686540-29686600)
chr3 (365-417)||(34238865-34238917)
chr3 (366-422)||(46622074-46622130)
chr3 (370-422)||(49324091-49324143)
chr3 (368-416)||(51760069-51760117)
chr3 (370-417)||(8555258-8555305)
chr3 (368-423)||(9596759-9596814)
chr3 (366-417)||(13514527-13514578)
chr3 (370-417)||(20757403-20757450)
chr3 (366-417)||(29446156-29446207)
chr3 (367-422)||(40169599-40169654)
chr3 (365-423)||(863596-863654)
chr3 (361-423)||(1721083-1721145)
chr3 (369-419)||(2486581-2486631)
chr3 (188-350)||(4143979-4144141)
chr3 (365-423)||(10778368-10778426)
chr3 (365-423)||(20644820-20644878)
chr3 (368-462)||(28418805-28418899)
chr3 (369-415)||(30034109-30034155)
chr3 (365-423)||(51759817-51759875)
chr3 (367-420)||(275780-275833)
chr3 (366-462)||(863280-863377)
chr3 (366-415)||(4321945-4321994)
chr3 (368-417)||(11463431-11463480)
chr3 (365-422)||(14633834-14633891)
chr3 (366-423)||(20405167-20405224)
chr3 (366-423)||(25710509-25710566)
chr3 (367-416)||(29678338-29678387)
chr3 (364-417)||(30130454-30130507)
chr3 (365-422)||(30552423-30552480)
chr3 (370-423)||(40545783-40545836)
chr3 (362-423)||(45521780-45521841)
chr3 (368-417)||(46186410-46186459)
chr3 (366-423)||(46901103-46901160)
chr3 (368-409)||(53113716-53113757)
chr3 (363-423)||(12673925-12673985)
chr3 (367-423)||(20644505-20644561)
chr3 (371-423)||(21970994-21971046)
chr3 (371-423)||(21993430-21993482)
chr3 (365-409)||(25353197-25353241)
chr3 (363-419)||(27200434-27200490)
chr3 (364-416)||(35533276-35533328)
chr3 (363-423)||(36732636-36732696)
chr3 (367-415)||(39072165-39072213)
chr3 (365-417)||(43440493-43440545)
chr3 (369-417)||(43440737-43440785)
chr3 (361-417)||(45161107-45161163)
chr3 (367-422)||(49670747-49670803)
chr3 (367-462)||(52956383-52956479)
chr3 (367-423)||(53701361-53701417)
chr3 (370-417)||(9863050-9863096)
chr3 (388-419)||(16123450-16123481)
chr3 (362-405)||(26273786-26273829)
chr3 (363-422)||(34582520-34582579)
chr3 (370-417)||(36672966-36673013)
chr3 (368-423)||(46724846-46724901)
chr3 (366-417)||(51500397-51500448)
chr3 (380-414)||(20644578-20644612)
chr3 (367-417)||(30424628-30424678)
chr3 (367-417)||(30426177-30426226)
chr3 (361-399)||(39132874-39132912)
chr3 (369-415)||(46621778-46621824)
chr3 (376-418)||(52956649-52956691)
chr3 (388-417)||(590197-590226)
chr3 (373-422)||(8510474-8510523)
chr3 (361-398)||(20585672-20585709)
chr3 (377-414)||(25610024-25610061)
chr3 (370-415)||(35177518-35177563)
chr3 (380-417)||(35565581-35565618)
chr3 (365-418)||(40279284-40279337)
chr3 (366-423)||(47114747-47114804)
chr3 (370-423)||(54767471-54767524)
chr3 (366-398)||(976779-976811)
chr3 (362-398)||(3416490-3416526)
chr3 (367-399)||(4705681-4705713)
chr3 (369-417)||(16679678-16679726)
chr3 (375-423)||(29490377-29490425)
chr3 (373-413)||(38232554-38232594)
chr3 (366-398)||(39820632-39820664)
chr3 (366-398)||(47433837-47433869)
chr3 (365-417)||(47901798-47901850)
chr3 (367-423)||(47902089-47902145)
chr3 (363-399)||(52401013-52401049)
chr3 (362-398)||(53121297-53121333)
[»] chr1 (207 HSPs)
chr1 (365-462)||(24507747-24507845)
chr1 (365-462)||(15058671-15058768)
chr1 (364-462)||(12360872-12360971)
chr1 (367-422)||(24507479-24507534)
chr1 (365-462)||(3247196-3247294)
chr1 (364-422)||(19622962-19623020)
chr1 (365-462)||(19720710-19720808)
chr1 (365-423)||(33045634-33045692)
chr1 (365-423)||(35307713-35307771)
chr1 (365-462)||(38164199-38164297)
chr1 (365-462)||(47819500-47819598)
chr1 (366-462)||(8140433-8140530)
chr1 (361-422)||(8140744-8140805)
chr1 (367-459)||(38151119-38151212)
chr1 (367-462)||(24653802-24653898)
chr1 (365-417)||(29688378-29688430)
chr1 (366-422)||(47819231-47819287)
chr1 (365-417)||(52254181-52254233)
chr1 (364-423)||(29072494-29072553)
chr1 (368-423)||(44157696-44157751)
chr1 (365-423)||(1810925-1810983)
chr1 (367-464)||(10631164-10631262)
chr1 (365-462)||(15526266-15526364)
chr1 (369-423)||(17129691-17129745)
chr1 (361-423)||(18302331-18302393)
chr1 (361-423)||(18899833-18899895)
chr1 (365-462)||(30322927-30323025)
chr1 (364-422)||(31061096-31061154)
chr1 (365-423)||(32626527-32626585)
chr1 (364-422)||(32728994-32729052)
chr1 (365-423)||(33234544-33234602)
chr1 (365-423)||(45368488-45368546)
chr1 (361-422)||(3247507-3247568)
chr1 (365-422)||(10631473-10631530)
chr1 (366-462)||(10887502-10887599)
chr1 (366-423)||(13770488-13770545)
chr1 (366-423)||(22919683-22919740)
chr1 (365-422)||(26061954-26062011)
chr1 (366-423)||(26324584-26324641)
chr1 (367-459)||(33000305-33000398)
chr1 (365-422)||(33000614-33000671)
chr1 (365-422)||(38163929-38163986)
chr1 (366-423)||(39747779-39747836)
chr1 (366-462)||(45638798-45638895)
chr1 (366-422)||(990324-990380)
chr1 (365-417)||(11822002-11822054)
chr1 (366-422)||(15516581-15516637)
chr1 (366-422)||(16026883-16026939)
chr1 (367-423)||(16060829-16060885)
chr1 (366-422)||(18473271-18473327)
chr1 (365-417)||(18473545-18473597)
chr1 (366-422)||(30323238-30323294)
chr1 (365-417)||(33379886-33379938)
chr1 (361-417)||(35005694-35005750)
chr1 (367-462)||(35056530-35056626)
chr1 (366-422)||(35056839-35056895)
chr1 (367-423)||(35308055-35308111)
chr1 (367-462)||(40718110-40718206)
chr1 (366-422)||(41358368-41358424)
chr1 (366-422)||(41358608-41358664)
chr1 (366-422)||(45380271-45380327)
chr1 (367-462)||(45380540-45380636)
chr1 (372-423)||(2939934-2939985)
chr1 (368-423)||(3753214-3753269)
chr1 (367-422)||(7001842-7001897)
chr1 (366-417)||(7819053-7819104)
chr1 (364-423)||(12361008-12361067)
chr1 (365-416)||(24654118-24654169)
chr1 (367-422)||(24977778-24977833)
chr1 (363-422)||(31258335-31258394)
chr1 (367-422)||(38136926-38136981)
chr1 (367-462)||(39025287-39025381)
chr1 (367-422)||(45638580-45638635)
chr1 (367-422)||(46868522-46868577)
chr1 (364-422)||(990085-990143)
chr1 (365-423)||(3679624-3679682)
chr1 (365-423)||(3753516-3753574)
chr1 (369-423)||(4789310-4789364)
chr1 (365-423)||(6567440-6567498)
chr1 (365-423)||(24978066-24978124)
chr1 (365-423)||(26442843-26442901)
chr1 (361-419)||(42483219-42483277)
chr1 (361-462)||(7350417-7350518)
chr1 (365-461)||(8364614-8364711)
chr1 (361-422)||(10887227-10887288)
chr1 (366-423)||(14007488-14007545)
chr1 (368-417)||(15058419-15058468)
chr1 (365-461)||(15211509-15211606)
chr1 (370-423)||(15335239-15335292)
chr1 (366-423)||(21391095-21391152)
chr1 (367-416)||(24649350-24649399)
chr1 (367-456)||(25658014-25658103)
chr1 (366-423)||(32454238-32454295)
chr1 (366-423)||(33045354-33045411)
chr1 (365-462)||(34002845-34002942)
chr1 (365-422)||(35005442-35005499)
chr1 (361-422)||(37545622-37545683)
chr1 (365-422)||(38150846-38150903)
chr1 (368-417)||(44641079-44641128)
chr1 (362-423)||(44641376-44641437)
chr1 (365-422)||(45290455-45290512)
chr1 (366-423)||(50429153-50429210)
chr1 (366-423)||(50799129-50799186)
chr1 (367-415)||(12322922-12322970)
chr1 (366-422)||(13260266-13260322)
chr1 (365-417)||(16060594-16060645)
chr1 (365-417)||(17984331-17984383)
chr1 (361-417)||(19622649-19622705)
chr1 (370-422)||(19721019-19721071)
chr1 (367-423)||(22953500-22953556)
chr1 (367-423)||(29072806-29072862)
chr1 (367-462)||(31060787-31060883)
chr1 (367-423)||(33234856-33234912)
chr1 (367-423)||(41738796-41738852)
chr1 (366-463)||(42482978-42483077)
chr1 (365-417)||(44157992-44158044)
chr1 (366-422)||(45290765-45290821)
chr1 (369-417)||(46183686-46183734)
chr1 (367-423)||(48956010-48956066)
chr1 (367-423)||(52254423-52254479)
chr1 (368-423)||(7818783-7818838)
chr1 (368-423)||(19198893-19198948)
chr1 (363-422)||(41881089-41881148)
chr1 (366-417)||(48609544-48609595)
chr1 (366-417)||(48955713-48955764)
chr1 (365-423)||(5058936-5058994)
chr1 (365-423)||(7867301-7867359)
chr1 (367-417)||(12322604-12322654)
chr1 (366-416)||(12360602-12360652)
chr1 (367-413)||(15211812-15211858)
chr1 (369-415)||(17130035-17130081)
chr1 (367-417)||(17984651-17984701)
chr1 (365-423)||(18079396-18079454)
chr1 (361-462)||(18928046-18928148)
chr1 (369-423)||(25658245-25658299)
chr1 (367-417)||(26191359-26191409)
chr1 (367-417)||(26191684-26191734)
chr1 (369-423)||(26207280-26207334)
chr1 (367-417)||(26442563-26442613)
chr1 (368-422)||(32420099-32420153)
chr1 (364-414)||(37624743-37624793)
chr1 (365-423)||(48609234-48609292)
chr1 (365-415)||(49073689-49073739)
chr1 (368-417)||(4323829-4323878)
chr1 (366-423)||(11822309-11822366)
chr1 (366-423)||(13259987-13260044)
chr1 (370-423)||(18900077-18900130)
chr1 (366-423)||(24649604-24649661)
chr1 (367-423)||(3679930-3679986)
chr1 (366-462)||(4565241-4565337)
chr1 (32-206)||(15500118-15500289)
chr1 (365-417)||(16026571-16026623)
chr1 (365-409)||(18079618-18079662)
chr1 (367-423)||(20948755-20948811)
chr1 (370-422)||(31258647-31258699)
chr1 (373-417)||(32035442-32035486)
chr1 (369-417)||(48730567-48730615)
chr1 (370-417)||(7350686-7350733)
chr1 (367-422)||(12158690-12158745)
chr1 (366-417)||(22674202-22674253)
chr1 (366-417)||(22919927-22919978)
chr1 (366-417)||(26324897-26324948)
chr1 (368-423)||(27521577-27521632)
chr1 (366-409)||(36912852-36912895)
chr1 (368-423)||(39303675-39303730)
chr1 (363-422)||(39747470-39747528)
chr1 (367-422)||(40718419-40718474)
chr1 (361-423)||(7867123-7867185)
chr1 (367-417)||(24510258-24510308)
chr1 (364-414)||(39025106-39025156)
chr1 (369-423)||(45368793-45368847)
chr1 (366-415)||(15334916-15334965)
chr1 (364-417)||(16083044-16083097)
chr1 (366-423)||(21383103-21383160)
chr1 (366-423)||(21383372-21383429)
chr1 (365-422)||(26062203-26062260)
chr1 (368-409)||(26142630-26142671)
chr1 (366-423)||(28507402-28507459)
chr1 (365-414)||(34002633-34002682)
chr1 (370-423)||(34808200-34808253)
chr1 (366-460)||(41739029-41739121)
chr1 (366-423)||(49923762-49923819)
chr1 (364-416)||(4360577-4360629)
chr1 (366-414)||(8364869-8364917)
chr1 (365-417)||(21391324-21391376)
chr1 (366-414)||(33067347-33067395)
chr1 (366-417)||(26142419-26142470)
chr1 (366-417)||(26699557-26699607)
chr1 (368-423)||(33067674-33067729)
chr1 (367-417)||(33380206-33380257)
chr1 (380-414)||(7350629-7350663)
chr1 (363-417)||(20756015-20756069)
chr1 (380-414)||(28507188-28507222)
chr1 (366-408)||(32035747-32035789)
chr1 (376-417)||(292868-292909)
chr1 (372-417)||(16083349-16083394)
chr1 (386-423)||(18302072-18302109)
chr1 (368-417)||(34382948-34382996)
chr1 (366-415)||(50428872-50428921)
chr1 (5-101)||(11896337-11896432)
chr1 (367-423)||(15466132-15466188)
chr1 (434-462)||(19622923-19622951)
chr1 (366-422)||(30962415-30962471)
chr1 (366-422)||(31404667-31404723)
chr1 (366-398)||(46073884-46073916)
chr1 (365-417)||(46868224-46868276)
chr1 (366-414)||(49074006-49074054)
[»] scaffold0026 (2 HSPs)
scaffold0026 (366-423)||(82650-82707)
scaffold0026 (361-422)||(82335-82396)
[»] scaffold0024 (2 HSPs)
scaffold0024 (366-462)||(75358-75455)
scaffold0024 (366-422)||(75709-75765)
[»] scaffold0003 (2 HSPs)
scaffold0003 (362-423)||(366217-366278)
scaffold0003 (367-423)||(365979-366035)
[»] scaffold1001 (1 HSPs)
scaffold1001 (364-423)||(2775-2834)
[»] scaffold0373 (1 HSPs)
scaffold0373 (361-422)||(8541-8602)
[»] scaffold0210 (2 HSPs)
scaffold0210 (366-423)||(14696-14753)
scaffold0210 (366-423)||(14956-15013)
[»] scaffold0179 (1 HSPs)
scaffold0179 (366-423)||(3235-3292)
[»] scaffold0160 (2 HSPs)
scaffold0160 (366-423)||(27308-27365)
scaffold0160 (380-414)||(27072-27106)
[»] scaffold0005 (3 HSPs)
scaffold0005 (365-422)||(47923-47980)
scaffold0005 (370-417)||(48181-48228)
scaffold0005 (360-417)||(223122-223179)
[»] scaffold0684 (2 HSPs)
scaffold0684 (361-417)||(2610-2666)
scaffold0684 (366-415)||(2333-2382)
[»] scaffold0535 (2 HSPs)
scaffold0535 (367-423)||(8972-9028)
scaffold0535 (369-423)||(8734-8788)
[»] scaffold0326 (4 HSPs)
scaffold0326 (365-417)||(4238-4290)
scaffold0326 (365-417)||(19420-19472)
scaffold0326 (366-417)||(4040-4091)
scaffold0326 (366-417)||(19222-19273)
[»] scaffold0176 (2 HSPs)
scaffold0176 (361-417)||(22005-22061)
scaffold0176 (365-399)||(21694-21728)
[»] scaffold0001 (2 HSPs)
scaffold0001 (367-423)||(148226-148282)
scaffold0001 (365-417)||(147888-147937)
[»] scaffold0056 (3 HSPs)
scaffold0056 (365-459)||(54813-54908)
scaffold0056 (370-422)||(50023-50075)
scaffold0056 (370-422)||(55124-55176)
[»] scaffold0007 (2 HSPs)
scaffold0007 (366-417)||(2500-2551)
scaffold0007 (367-409)||(2841-2883)
[»] scaffold0712 (1 HSPs)
scaffold0712 (365-415)||(5207-5257)
[»] scaffold0709 (1 HSPs)
scaffold0709 (365-415)||(5227-5277)
[»] scaffold0370 (1 HSPs)
scaffold0370 (364-422)||(234-292)
[»] scaffold0065 (2 HSPs)
scaffold0065 (365-423)||(3862-3920)
scaffold0065 (367-417)||(3532-3582)
[»] scaffold0811 (2 HSPs)
scaffold0811 (365-422)||(1309-1366)
scaffold0811 (365-422)||(1589-1646)
[»] scaffold0085 (2 HSPs)
scaffold0085 (366-423)||(35028-35085)
scaffold0085 (370-461)||(34724-34816)
[»] scaffold0016 (2 HSPs)
scaffold0016 (366-423)||(10459-10516)
scaffold0016 (367-417)||(10168-10218)
[»] scaffold0011 (3 HSPs)
scaffold0011 (366-419)||(189328-189381)
scaffold0011 (365-415)||(189630-189680)
scaffold0011 (365-422)||(61630-61687)
[»] scaffold0051 (2 HSPs)
scaffold0051 (365-417)||(5397-5449)
scaffold0051 (363-422)||(5653-5712)
[»] scaffold0021 (2 HSPs)
scaffold0021 (367-423)||(12182-12238)
scaffold0021 (367-417)||(12486-12536)
[»] scaffold0337 (1 HSPs)
scaffold0337 (367-462)||(12525-12620)
[»] scaffold0159 (1 HSPs)
scaffold0159 (367-422)||(34931-34986)
[»] scaffold0347 (2 HSPs)
scaffold0347 (367-413)||(4266-4312)
scaffold0347 (374-422)||(4016-4064)
[»] scaffold0123 (1 HSPs)
scaffold0123 (361-423)||(17987-18049)
[»] scaffold0166 (1 HSPs)
scaffold0166 (366-423)||(24371-24428)
[»] scaffold0078 (2 HSPs)
scaffold0078 (366-415)||(3751-3800)
scaffold0078 (366-417)||(4029-4080)
[»] scaffold0002 (2 HSPs)
scaffold0002 (366-415)||(94056-94105)
scaffold0002 (368-415)||(94282-94329)
[»] scaffold0119 (1 HSPs)
scaffold0119 (367-423)||(16724-16780)
[»] scaffold0105 (1 HSPs)
scaffold0105 (367-423)||(17910-17966)
[»] scaffold0060 (2 HSPs)
scaffold0060 (365-417)||(8328-8380)
scaffold0060 (365-417)||(8592-8644)
[»] scaffold0578 (1 HSPs)
scaffold0578 (365-423)||(5014-5072)
[»] scaffold0472 (1 HSPs)
scaffold0472 (361-415)||(7216-7270)
[»] scaffold0204 (1 HSPs)
scaffold0204 (369-421)||(17126-17178)
[»] scaffold0008 (1 HSPs)
scaffold0008 (367-415)||(44158-44206)
[»] scaffold0339 (1 HSPs)
scaffold0339 (367-417)||(3405-3455)
[»] scaffold0562 (1 HSPs)
scaffold0562 (361-398)||(9916-9953)
[»] scaffold0106 (1 HSPs)
scaffold0106 (366-398)||(30935-30967)


Alignment Details
Target: chr2 (Bit Score: 377; Significance: 0; HSPs: 184)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 5 - 475
Target Start/End: Original strand, 32475730 - 32476204
Alignment:
5 agtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtgtgt 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
32475730 agtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgaaaacatacaagctaatttatagaagattatgtgtgt 32475829  T
105 cgtggatcacaaaatatgtcggtgcaagacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttgagccctccctcaccatataaag 204  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32475830 cgtggaccacaaaatatgtcggtgcaagacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttgagccctccctcaccatataaag 32475929  T
205 taagaattttaacag---tcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatcattcgaaatagttcagagtttcg 301  Q
    |||||||||||||||   ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||    
32475930 taagaattttaacagtactcttgaaccagttcatattatataatccaaacatttcttggtcgtgttcggataatatcattcgaaatagttcaaagtttcg 32476029  T
302 atggttacttgttcagcaagagtaacttattgaacatgtttttctttggattttaccagttttaaggctaaaatatggttttgatccctgcaaatatgcc 401  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||    
32476030 atggttacttgctcagcaagagtaacttattgaacatgtttttctttggtttttaccagtttcaaggctaaaatatggttttgatccctgcaaatatgcc 32476129  T
402 tcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttgatccgttttacat 475  Q
    || ||||||||||||| |||||         || ||||||||||||||||||||||||||| || ||||||||||    
32476130 tcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttaattcgttttacat 32476204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 29859878 - 29859776
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
29859878 ttttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaatttttgttgtttttggtccctgcaaaatatt 29859779  T
460 ttg 462  Q
    |||    
29859778 ttg 29859776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 362 - 459
Target Start/End: Complemental strand, 2481562 - 2481464
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
2481562 tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 2481464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 4423890 - 4423951
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
4423890 tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 4423951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 24358947 - 24358890
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
24358947 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 24358890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 4042608 - 4042660
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
4042608 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 4042660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 11788417 - 11788321
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||        || ||||||||||||||||||||||||||||    
11788417 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaattttttttgttgtttttggtccctgcaaaatattttg 11788321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 363 - 462
Target Start/End: Complemental strand, 15842827 - 15842727
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || |||||||||||||||||||||||||||    
15842827 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatatttt 15842728  T
462 g 462  Q
    |    
15842727 g 15842727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 369 - 461
Target Start/End: Complemental strand, 29182440 - 29182348
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    |||||||||| |||||||||||||||||||| |||||||||||||||||| ||||        || |||||||||||||||||||||||||||    
29182440 ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtttctgtaaaaaaaattgttgtttttggtccctgcaaaatatttt 29182348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 37910755 - 37910851
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||||||| |||||||||||||| |||| |||||||| |||||        || ||||||||||||||||||||||||||||    
37910755 aggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattttg 37910851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 16522988 - 16523047
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
16522988 taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 16523047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 366 - 464
Target Start/End: Complemental strand, 16523326 - 16523227
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttgat 464  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||| |||||||||||||||    
16523326 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgat 16523227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 8046327 - 8046385
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||    
8046327 aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt 8046385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 14003744 - 14003646
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
14003744 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttg 14003646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 25705083 - 25705181
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
25705083 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 25705181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 33575746 - 33575848
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||          || |||||||||||||||||||||||||    
33575746 tttttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatt 33575845  T
460 ttg 462  Q
    |||    
33575846 ttg 33575848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 1138360 - 1138263
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||         || ||||||||||||||||||||||||||||    
1138360 aggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaattttttgttgttgtttttggtccctgcaaaatattttg 1138263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 13215059 - 13215156
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
13215059 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg 13215156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 24358615 - 24358712
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
24358615 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattttg 24358712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 33732857 - 33732918
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
33732857 tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 33732918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 42696202 - 42696153
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
42696202 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 42696153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 20131681 - 20131585
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
20131681 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 20131585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 22881607 - 22881663
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
22881607 ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 22881663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 25705450 - 25705394
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
25705450 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25705394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 40124966 - 40125022
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
40124966 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgt 40125022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||    
4794130 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 4794185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
5334751 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5334806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
5335040 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5334985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 10374775 - 10374830
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
10374775 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 10374830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 362 - 417
Target Start/End: Complemental strand, 17541781 - 17541726
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
17541781 tttaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 17541726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 18113086 - 18113145
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||    
18113086 taaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgt 18113145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 36815838 - 36815779
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||    
36815838 taaggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgt 36815779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 4424187 - 4424129
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
4424187 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 4424129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 360 - 422
Target Start/End: Original strand, 14003402 - 14003464
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
14003402 gtttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 14003464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 16900209 - 16900151
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
16900209 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 16900151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 16993600 - 16993542
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
16993600 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 16993542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 24483893 - 24483835
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
24483893 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 24483835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 37272105 - 37272047
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
37272105 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37272047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 40125295 - 40125193
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||| ||||| |||||||||||||||||| |||| |||||||| |||||         || |||||||||||||||||||||||||    
40125295 ttttaaggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 40125196  T
460 ttg 462  Q
    |||    
40125195 ttg 40125193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 369 - 422
Target Start/End: Original strand, 146328 - 146381
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
146328 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 146381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 19184153 - 19184096
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
19184153 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 19184096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 20131311 - 20131372
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
20131311 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 20131372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 26814231 - 26814174
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
26814231 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 26814174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 30215420 - 30215477
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
30215420 aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 30215477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 360 - 417
Target Start/End: Original strand, 31644834 - 31644891
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||    
31644834 gtttaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 31644891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 33576119 - 33576062
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
33576119 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33576062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 37271737 - 37271794
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
37271737 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37271794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 38980255 - 38980198
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
38980255 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 38980198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 43671929 - 43671990
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||  |||||| |||||||| ||||||||||||||||||||||    
43671929 tttaaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgt 43671990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 44559061 - 44559118
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
44559061 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 44559118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 44985985 - 44985928
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||    
44985985 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt 44985928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 146690 - 146594
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| ||||||||||||||  |||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
146690 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 146594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 9195054 - 9195110
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
9195054 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 9195110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
15842464 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 15842516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 16673772 - 16673716
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||    
16673772 aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg 16673716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 20939329 - 20939269
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
20939329 ttaacgctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 20939269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
29859490 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29859542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 34317798 - 34317854
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||    
34317798 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt 34317854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 363 - 415
Target Start/End: Complemental strand, 37911124 - 37911072
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||||| ||||||||||||||| ||||||||||||||    
37911124 ttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta 37911072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 41451836 - 41451892
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
41451836 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 41451892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 362 - 422
Target Start/End: Complemental strand, 44073812 - 44073752
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
44073812 tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 44073752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 38731826 - 38731885
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| |||||  |||||||||||||||||||||||||||||||| |||||    
38731826 taaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt 38731885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 43788857 - 43788908
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
43788857 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 43788908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 1137983 - 1138037
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| || |||||    
1137983 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgt 1138037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 11713847 - 11713789
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||||  |||||||||||||||||||||||||||||||| |||||    
11713847 aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 11713789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 17302145 - 17302087
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||| |||||    
17302145 aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt 17302087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 23732039 - 23732089
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| |||||||||||||||||||| |||||||||||||||||    
23732039 ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt 23732089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 27109073 - 27109123
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| ||||| ||||||||||||||||||||||||||    
27109073 ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt 27109123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 31225713 - 31225771
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||  |||||||||||||||||||||||| |||||||||||||    
31225713 aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgt 31225771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 42358697 - 42358755
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
42358697 aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 42358755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 42695868 - 42695918
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||||    
42695868 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 42695918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 43672320 - 43672222
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||| ||||| ||||||||||||||  | |||||||||||||| |||||         |||||||||||||||||||||||||||||||    
43672320 aaggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaaaaattttttattgtttttggtccctgcaaaatattttg 43672222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 44985623 - 44985677
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
44985623 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 44985677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 9195207 - 9195150
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||   ||||||||||||||||||||||||||||||| |||||    
9195207 aggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgt 9195150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 10671629 - 10671686
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||  ||||||||||||||||| |||||    
10671629 aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgt 10671686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 16673409 - 16673466
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||    
16673409 aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 16673466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 17541380 - 17541437
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||| ||||||||||||||||||||||||||| ||||    
17541380 aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 17541437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 19183780 - 19183837
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
19183780 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 19183837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 26707872 - 26707929
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| | |||||||||||||||| |||||    
26707872 aggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgt 26707929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 35686335 - 35686282
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||| |||||||| ||||||||||||||||| ||||    
35686335 taaaatatggttttgatccctgtaaatatgcttcgttttggttttagtttctgt 35686282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 40302340 - 40302283
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
40302340 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt 40302283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 43592045 - 43592102
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
43592045 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 43592102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 43597153 - 43597210
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  | |||||||||||||||||||||||||||||| |||||    
43597153 aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt 43597210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 361 - 422
Target Start/End: Complemental strand, 43789198 - 43789137
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||  | ||||||||||||| |||||||||||||||| ||||    
43789198 ttttaaggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg 43789137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 3172018 - 3172070
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||| |||||||||||||||||| |||||||||||||    
3172018 aaggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagt 3172070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 3172534 - 3172482
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||| ||| ||||||||||||||||||||||||||||    
3172534 aaggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagt 3172482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 3671192 - 3671136
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||  |||||||||||||||||||||||||||||||| |||||    
3671192 ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 3671136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 372 - 460
Target Start/End: Complemental strand, 4794468 - 4794380
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattt 460  Q
    ||||||||||||| ||||| |||||||| |||||||||||||||||  ||||        || ||||||||||||||||||||||||||    
4794468 aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgtaaaaaaaattgttgtttttggtccctgcaaaatattt 4794380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 8046648 - 8046592
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||| |||||||||||||||||||||||||| |||||    
8046648 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 8046592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 11713485 - 11713541
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
11713485 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 11713541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 413
Target Start/End: Complemental strand, 23732330 - 23732282
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||||| || |||||||||||||||||||||||||    
23732330 aaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt 23732282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 23989832 - 23989888
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||| ||||  ||||||||||||||||||||||||||||||||    
23989832 tttttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 23989888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 413
Target Start/End: Original strand, 27310874 - 27310922
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||    
27310874 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt 27310922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 413
Target Start/End: Original strand, 29831812 - 29831860
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    ||||||||||||| ||||||||||||||||||||| |||||||||||||    
29831812 aaggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt 29831860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
31226077 ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta 31226029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
33733241 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 33733193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 36622250 - 36622306
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
36622250 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 36622306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 371 - 423
Target Start/End: Complemental strand, 36806892 - 36806840
Alignment:
371 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
36806892 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 36806840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 37228731 - 37228783
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| ||||||||||||||  ||||||||||||||||    
37228731 aaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagt 37228783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 41694003 - 41693947
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
41694003 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 41693947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 44559407 - 44559359
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||    
44559407 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 44559359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 44994063 - 44994011
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| ||||||||||||||| |||||||| ||||||||    
44994063 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagt 44994011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 3838263 - 3838208
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
3838263 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 3838208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||| ||  |||||||||||||||||||||||||||||||| ||||    
5790558 ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg 5790613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
5790899 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 5790844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 360 - 423
Target Start/End: Complemental strand, 7814744 - 7814681
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||| ||||  |||||||||||||||||| ||||||||||||| |||||    
7814744 gtttttaggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt 7814681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 10671942 - 10671891
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
10671942 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 10671891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
26813866 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 26813921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 27311070 - 27311019
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||| ||||||||||||||||||||||||||||    
27311070 aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagt 27311019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 29865222 - 29865277
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
29865222 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 29865277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 30215872 - 30215774
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt--nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||  | ||||||||||||||| |||||          || ||||||||||||||||||||||||||||    
30215872 aggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttg 30215774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 31909479 - 31909429
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||||    
31909479 aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagt 31909429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 38639411 - 38639462
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
38639411 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 38639462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 4042890 - 4042840
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||| | |||||||||||||| |||||||||||||||||    
4042890 ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagt 4042840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 10665296 - 10665238
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||  || |||||||||||| ||||||||||||||||||||||    
10665296 aaggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgt 10665238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 34318083 - 34318033
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| ||||| |||||||||||||||||| |||||||    
34318083 ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagt 34318033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 36622582 - 36622528
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  ||||||||||||||| ||||||||||||||||| ||||    
36622582 ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtttctgt 36622528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 40301973 - 40302031
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||| |||| |||||||| |||||    
40301973 aaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgt 40302031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 40786454 - 40786516
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  || ||||||||||| ||||||||||||||||| |||||    
40786454 tttttaggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgt 40786516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 41693672 - 41693730
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||  |||||||||||||||| |||||    
41693672 aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 41693730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 1295544 - 1295491
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||||||||||||  |||||||||||||||| |||||    
1295544 taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgt 1295491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 369 - 422
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||  ||| |||||||||||||||||||||||||||| ||||    
1497943 ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg 1497890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 2481191 - 2481248
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| | | |||||||||| ||||||||||||||||| ||||    
2481191 aaggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg 2481248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 3671002 - 3671059
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||| |||||||||||||||||||| ||||||| |||||    
3671002 aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt 3671059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 7814244 - 7814301
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||| |||||  |||||| ||||||||||||||||||||||||| ||||    
7814244 aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg 7814301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 13850521 - 13850578
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||||||| ||||||||||| |||| |||||||||||| |||||    
13850521 aggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgt 13850578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 20658060 - 20658117
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| ||||||||  ||||||||||||||||| |||||||||||||| |||||    
20658060 aggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 20658117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 29865512 - 29865455
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||| ||||||||||| |||||||||||||||| |||||    
29865512 aggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgt 29865455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 416
Target Start/End: Complemental strand, 34964159 - 34964110
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||||||||||||||||| |||||||||||||| |||||||| |||||||    
34964159 ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag 34964110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 36815487 - 36815584
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||  | ||| ||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
36815487 aggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 36815584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 43710713 - 43710652
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||||   || |||||||||||||||||||||||||||| |||||    
43710713 tttaaggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgt 43710652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 1497610 - 1497666
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||| |||||||||||||||||||| ||||||| |||||    
1497610 ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt 1497666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 2265401 - 2265341
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| ||||  ||| |||||||||| ||||||||||||||||| |||||    
2265401 ttaaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgt 2265341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 10375069 - 10375021
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||    
10375069 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 10375021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 12835325 - 12835381
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||  |||||||||||||||||| ||||||||||||| |||||    
12835325 ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt 12835381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 414
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||| |||| |||||||||||||| ||||||||||||||    
13215366 aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt 13215318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 363 - 423
Target Start/End: Original strand, 16968548 - 16968608
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||| ||||||||||||||  ||||| ||||||||||| |||||||||||||| |||||    
16968548 ttaaggttaaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgt 16968608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #138
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 18113454 - 18113406
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||| ||||| ||||||||| ||||||||||||||    
18113454 ggctaaaatatggttttggtccctacaaatatgcttcgttttggtttta 18113406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #139
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 414
Target Start/End: Complemental strand, 20658410 - 20658362
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||| ||||||||||||||| ||||||||| ||||    
20658410 aggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt 20658362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #140
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 26239161 - 26239105
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
26239161 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 26239105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #141
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 38231431 - 38231487
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||||||||||||||||| ||| |||||| ||||||| |||||    
38231431 ggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgt 38231487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #142
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 43597503 - 43597443
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| ||||  ||||||| |||||| ||||||||||||||||| |||||    
43597503 ttaaggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt 43597443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #143
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 3832634 - 3832587
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| ||||||||||||||  ||||||||||||||||    
3832634 taaaatatggttttggtccctgcaaatatgtttcgttttggttttagt 3832587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #144
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 13850881 - 13850834
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| | ||||||||||||| ||||||||||||||||    
13850881 taaaatatggttttggttcctgcaaatatgcttcgttttggttttagt 13850834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #145
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 17912808 - 17912761
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||  | ||||||||||||||||||||||||||||||    
17912808 taaaatatggttttagttcctgcaaatatgcctcgttttggttttagt 17912761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #146
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 24483401 - 24483456
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||  ||| |||||||||||||||||||||||||||| |||||    
24483401 gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgt 24483456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #147
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 25954429 - 25954370
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||||  ||| |||||||||||||||||||| ||||||| |||||    
25954429 taaggttaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt 25954370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #148
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 362 - 417
Target Start/End: Complemental strand, 38231826 - 38231771
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||| ||||||||| ||||||||||| ||||||||| |||||||| |||||||    
38231826 tttaaggttaaaatatgattttgatccctccaaatatgcttcgttttgattttagt 38231771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #149
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 3837931 - 3837989
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||  |||||||||||||| |||||||| |||||||| |||||    
3837931 aaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgt 3837989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #150
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 5006605 - 5006663
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||| || ||||||||||  |||||||||||||||||| ||||    
5006605 aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgt 5006663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #151
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 26238811 - 26238869
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
26238811 aaggttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 26238869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #152
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 31326254 - 31326196
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||  ||| ||||||||||||||||||| |||||||| |||||    
31326254 aaggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgt 31326196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #153
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 35155621 - 35155563
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||| ||||||| || |||||| ||||||| |||||    
35155621 aaggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgt 35155563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 39367762 - 39367664
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||| |||||||||| |||||||| |  |||||||||||||  ||||         || ||||||||||||||||||||||||||||    
39367762 aaggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 39367664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #155
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 41791020 - 41791074
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||| ||||||||||| ||||||||||||| |||||    
41791020 ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt 41791074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 413
Target Start/End: Complemental strand, 41791312 - 41791266
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||  ||||||||||||||| ||||||||||||    
41791312 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttt 41791266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #157
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 4842865 - 4842914
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||   |||||||||||| |||||||||||||||||    
4842865 gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagt 4842914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #158
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 10664983 - 10665040
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| | ||||| |||||    
10664983 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgt 10665040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #159
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 19831503 - 19831564
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||| ||||||||||||||  ||  ||||||||||  ||||||||||||||||||||||    
19831503 tttaaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt 19831564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #160
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 32691312 - 32691361
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||  |  |||||||||||||||||||||||||||    
32691312 aggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta 32691361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #161
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 364 - 417
Target Start/End: Complemental strand, 45442699 - 45442646
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| ||||  ||| |||||||||| |||||||||||||||||    
45442699 taaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagt 45442646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 369 - 421
Target Start/End: Complemental strand, 25300038 - 25299987
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 421  Q
    |||||||||||||||| ||||||||||||||  || |||||||||||||||||    
25300038 ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagttcct 25299987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 25954113 - 25954165
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||  ||||||||||||||  ||||||||||||||||    
25954113 aaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagt 25954165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 31325920 - 31325976
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| |  ||||||||||||||| ||||||| |||||||| |||||    
31325920 ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgt 31325976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #165
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 373 - 417
Target Start/End: Original strand, 35155298 - 35155342
Alignment:
373 aatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||  |||||||||||||| |||||||||||||||||    
35155298 aatatggttttagtccctgcaaatatgtctcgttttggttttagt 35155342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #166
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 370 - 418
Target Start/End: Complemental strand, 37229039 - 37228991
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    ||||||||||||||| |||||||||||||   |||||||||||||||||    
37229039 taaaatatggttttggtccctgcaaatatatttcgttttggttttagtt 37228991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #167
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 370 - 417
Target Start/End: Original strand, 17912452 - 17912499
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||| ||||  |||||||||||||| |||||||||||||||||    
17912452 taaaatatgattttagtccctgcaaatatgtctcgttttggttttagt 17912499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #168
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 23990193 - 23990146
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||  ||| |||||||||| |||||||||||||||||    
23990193 taaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 23990146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 14393132 - 14393079
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||| ||| | ||| |||||||||| |||||||||||||||||    
14393132 ttaaggctaaaatatgatttagttcc-tgcaaatatgtctcgttttggttttagt 14393079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 25299747 - 25299801
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| ||||| |||||||||||||| ||||||||  ||||||| |||||    
25299747 ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgt 25299801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 414
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||| |||||||||||||||||||||||||||||    
29831885 ttttggtccctgcaaatatgcctcgttttggtttt 29831919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #172
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 415
Target Start/End: Original strand, 13802481 - 13802534
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||  | | || |||||| ||||||||||||||||    
13802481 tttaaggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta 13802534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #173
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 415
Target Start/End: Complemental strand, 16900129 - 16900100
Alignment:
386 tccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||||||||||    
16900129 tccctgcaaatatgcctcgttttggtttta 16900100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #174
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 415
Target Start/End: Complemental strand, 16993520 - 16993491
Alignment:
386 tccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||||||||||    
16993520 tccctgcaaatatgcctcgttttggtttta 16993491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #175
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 423
Target Start/End: Complemental strand, 22881949 - 22881912
Alignment:
386 tccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||||||||||||||| |||||    
22881949 tccctgcaaatatgtctcgttttggttttagtccctgt 22881912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #176
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 34963796 - 34963845
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||||||| ||||||  | |||||| |||||||    
34963796 gctaaaatatggttttgatccctgctaatatgttttgttttgattttagt 34963845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #177
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||  || ||||||||||| ||||||||| |||||    
45442315 aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta 45442364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #178
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 370 - 414
Target Start/End: Complemental strand, 5164482 - 5164438
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||||||| |||||||||||| || ||||| |||||    
5164482 taaaatatggttttgattcctgcaaatatgtcttgttttagtttt 5164438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #179
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 11788052 - 11788108
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| | |||||| ||||||| ||| |||||||| |||||||| |||||    
11788052 ggctaaaatatgatgttgatctctgcaaaaatgtctcgttttcgttttagtccctgt 11788108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #180
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Complemental strand, 12068405 - 12068373
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||| |||||||||||||||||||    
12068405 aggctaaaatatgcttttgatccctgcaaatat 12068373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #181
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 387 - 423
Target Start/End: Complemental strand, 26708184 - 26708148
Alignment:
387 ccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| ||||||||||||||||||| |||||    
26708184 ccctgcaaatacgcctcgttttggttttagtccctgt 26708148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #182
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 29182166 - 29182218
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||| ||| ||||||||||  || |||||||||||||    
29182166 aaggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagt 29182218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #183
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 304 - 344
Target Start/End: Complemental strand, 32121914 - 32121874
Alignment:
304 ggttacttgttcagcaagagtaacttattgaacatgttttt 344  Q
    ||||||||||||||||||||| ||| || ||||||||||||    
32121914 ggttacttgttcagcaagagtgactcatggaacatgttttt 32121874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #184
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 38979889 - 38979945
Alignment:
367 ggctaaaatatggttttgatccctgcaaatat-gcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||   ||||||||||||||||| ||||    
38979889 ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg 38979945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 59; Significance: 9e-25; HSPs: 180)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 365 - 459
Target Start/End: Original strand, 11976371 - 11976465
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||        || |||||||||||||||||||||||||    
11976371 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatatt 11976465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 4474049 - 4473988
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
4474049 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt 4473988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 10872913 - 10872971
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
10872913 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt 10872971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 14495067 - 14495164
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||| |||||    
14495067 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttg 14495164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 363 - 462
Target Start/End: Original strand, 28346390 - 28346490
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || |||||||||||||||||||||||||||    
28346390 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatatttt 28346489  T
462 g 462  Q
    |    
28346490 g 28346490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 364 - 462
Target Start/End: Complemental strand, 7420593 - 7420494
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
7420593 taaggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 7420494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 7326421 - 7326324
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt--nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||          ||||||||||||||||||| |||||||||||    
7326421 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttttattgtttttggtccctgtaaaatattttg 7326324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 8298977 - 8298879
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
8298977 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 8298879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 10337113 - 10337215
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
10337113 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 10337212  T
460 ttg 462  Q
    |||    
10337213 ttg 10337215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 24187563 - 24187625
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||    
24187563 ttttaaggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgt 24187625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 34963297 - 34963355
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
34963297 taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 34963355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 37536084 - 37536182
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
37536084 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttg 37536182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 4710221 - 4710124
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
4710221 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 4710124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 6469279 - 6469376
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||| |||  ||||||||||||||||||||||||||||||||||||||         || ||||||||||||||||||||||||||||    
6469279 aggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 6469376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 9496340 - 9496437
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||          || ||||||||||||||||||||||||||||    
9496340 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 9496437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 25600229 - 25600286
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||    
25600229 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgt 25600286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 10776499 - 10776443
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
10776499 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 10776443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 11019858 - 11019802
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
11019858 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 11019802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 14239084 - 14239024
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
14239084 ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 14239024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 27117752 - 27117848
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||||        || ||||||||||||||||||||| ||||||    
27117752 aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaagattttg 27117848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 362 - 462
Target Start/End: Original strand, 28323844 - 28323944
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    |||||||||||||||||||| |  ||||||||||||||| |||||||||||||||| ||| |        || |||||||||||||||||||||||||||    
28323844 tttaaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccctttaaaaaaaattgttgtttttggtccctgcaaaatatttt 28323943  T
462 g 462  Q
    |    
28323944 g 28323944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 28346759 - 28346703
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
28346759 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28346703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 32726272 - 32726216
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
32726272 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 32726216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 34963664 - 34963568
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          |||||||||||||||||||||||||||||||    
34963664 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttattgtttttggtccctgcaaaatattttg 34963568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
2728597 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 2728542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 359 - 422
Target Start/End: Complemental strand, 9496731 - 9496668
Alignment:
359 agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
9496731 agttctaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 9496668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 10540785 - 10540726
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||    
10540785 taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt 10540726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 363 - 422
Target Start/End: Original strand, 11019516 - 11019575
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
11019516 ttaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 11019575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 16789072 - 16789131
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
16789072 taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 16789131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
35097692 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35097637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 2811785 - 2811731
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| |||||||||||||||||||||||||||||| |||||||||||||||||    
2811785 ttaaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 2811731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 16789375 - 16789313
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
16789375 ttttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 16789313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 20277690 - 20277748
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||    
20277690 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt 20277748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 20984144 - 20984202
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
20984144 aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgt 20984202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 21064317 - 21064375
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||    
21064317 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt 21064375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 22917561 - 22917619
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
22917561 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 22917619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 25131109 - 25131167
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
25131109 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 25131167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 27341593 - 27341535
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
27341593 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 27341535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 32725905 - 32726003
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
32725905 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 32726003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 40066495 - 40066553
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||||||||||| ||||||||||||||    
40066495 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgt 40066553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 43477161 - 43477219
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
43477161 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 43477219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 3511905 - 3512002
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
3511905 aggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 3512002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 414
Target Start/End: Complemental strand, 3680803 - 3680754
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||    
3680803 aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt 3680754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 7420228 - 7420285
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
7420228 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 7420285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 13154885 - 13154942
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||    
13154885 aggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgt 13154942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 24090487 - 24090438
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||    
24090487 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 24090438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 35097327 - 35097424
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
35097327 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 35097424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 35346999 - 35346902
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
35346999 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 35346902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 1525807 - 1525859
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
1525807 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 1525859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 3512267 - 3512211
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
3512267 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3512211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 4621354 - 4621298
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||    
4621354 ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgt 4621298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 7186004 - 7185948
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
7186004 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 7185948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 7326085 - 7326141
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||    
7326085 aggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg 7326141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 8298587 - 8298643
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
8298587 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 8298643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 10337450 - 10337394
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||    
10337450 aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 10337394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 419
Target Start/End: Complemental strand, 13232562 - 13232510
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||||| |||||||||||||||||| |||||||||||||||    
13232562 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttc 13232510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 14489073 - 14489017
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
14489073 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 14489017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 362 - 422
Target Start/End: Complemental strand, 16644049 - 16643989
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
16644049 tttaaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg 16643989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 19494118 - 19494174
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||||||||    
19494118 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 19494174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
19494414 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 19494358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 32418316 - 32418368
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
32418316 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 32418368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 42133154 - 42133098
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
42133154 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 42133098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 1778564 - 1778619
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
1778564 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1778619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 5357422 - 5357473
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
5357422 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt 5357473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| || ||||||||||||||||||||||||||||| ||||    
10873280 ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 10873225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 20278058 - 20278007
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||||||    
20278058 aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagt 20278007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 21064685 - 21064634
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||||||    
21064685 aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagt 21064634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
35346629 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35346684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
37536419 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 37536364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 2728230 - 2728328
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||| ||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
2728230 aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 2728328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 415
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||    
13779151 ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta 13779197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 14238749 - 14238807
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
14238749 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 14238807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 20984512 - 20984454
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||||    
20984512 aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt 20984454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 359 - 417
Target Start/End: Complemental strand, 24955018 - 24954960
Alignment:
359 agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
24955018 agtttttaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagt 24954960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 29488112 - 29488054
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
29488112 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt 29488054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 38930299 - 38930357
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||| ||||||| ||||||||||||||||||||||    
38930299 taaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg 38930357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 44997929 - 44997987
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||| |||||||||||||||||||||||| ||||| |||||||    
44997929 aaggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgt 44997987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 4017302 - 4017245
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  ||| |||||||||||||||||||||||||||| ||||    
4017302 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 4017245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 423
Target Start/End: Original strand, 13232201 - 13232254
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
13232201 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 13232254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 462
Target Start/End: Complemental strand, 13796593 - 13796500
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||| |||||||||||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
13796593 taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg 13796500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 17073806 - 17073863
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||    
17073806 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt 17073863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 17574464 - 17574407
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||    
17574464 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt 17574407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 456
Target Start/End: Complemental strand, 25131447 - 25131358
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaat 456  Q
    |||||||||||||||||  | |||||||||||||||||||||||||||||| ||| |         ||||||||||||||||||||||||    
25131447 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctctaaaaaaaaatattgtttttggtccctgcaaaat 25131358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 414
Target Start/End: Complemental strand, 27117978 - 27117929
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||    
27117978 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttt 27117929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 454
Target Start/End: Original strand, 28497253 - 28497342
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaa 454  Q
    |||||||||||||| ||||| ||||||||||||||||||||||| |||||||| | |||        || ||||||||||||||||||||    
28497253 aaggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtccatgtaattttttttgttgtttttggtccctgcaaa 28497342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 28497616 - 28497563
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||||| |||||    
28497616 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt 28497563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 29158353 - 29158410
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
29158353 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 29158410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 29992301 - 29992244
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||| |||||||||||||||||||||||| ||||||| |||||    
29992301 aggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgt 29992244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 33526413 - 33526356
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
33526413 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 33526356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 1526173 - 1526117
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
1526173 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg 1526117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 1685112 - 1685164
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||  ||||||||||||||||||||||||||||||||    
1685112 aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 1685164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 415
Target Start/End: Original strand, 4375692 - 4375740
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
4375692 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 4375740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 4473703 - 4473759
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||| | ||||||||||||||||| ||||    
4473703 aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 4473759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 6146510 - 6146566
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| ||||||||||||||||  ||| ||||||||||||||||||||||||||||    
6146510 ttttaaagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 6146566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 7272418 - 7272470
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||    
7272418 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 7272470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 7272751 - 7272695
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||   ||||||||||||||||||||||||||||||| |||||    
7272751 ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgt 7272695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
11976733 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 11976681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 368 - 416
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||||||||||| |||| |||||||||||||||||||||||||||||||    
13779531 gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag 13779483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 14847823 - 14847875
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||| |||||||||||||||||||||||| |||||||||||||    
14847823 aaggttaaaatatgattttgatccctgcaaatatgcctcattttggttttagt 14847875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 16643660 - 16643716
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  ||||||||||||||||| |||||||||||||| ||||    
16643660 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 16643716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 28324185 - 28324125
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||| ||||| |||||||| || |||||||||||||| |||||    
28324185 ttaaggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgt 28324125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 31445465 - 31445413
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| |||||||||||| |||||||||||| |||||||||||||    
31445465 aaggctaaaatatagttttgatccctacaaatatgcctcattttggttttagt 31445413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 35143845 - 35143789
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||| || ||||||||||||||||||||||||| ||||    
35143845 aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg 35143789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 40066820 - 40066764
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||| ||||||||||||||| |||||    
40066820 ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgt 40066764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 40844156 - 40844212
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
40844156 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 40844212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 415
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||    
42132864 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 42132912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 372 - 423
Target Start/End: Original strand, 3680532 - 3680583
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
3680532 aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgt 3680583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 415
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||    
4016906 gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 4016953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 6146948 - 6146893
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
6146948 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt 6146893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 8094842 - 8094791
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||| ||||||||||||||||||||||||||||    
8094842 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 8094791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 9175368 - 9175321
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| |||||| |||||||||||||||||||||||||    
9175368 taaaatatggttttggtccctgtaaatatgcctcgttttggttttagt 9175321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 10540448 - 10540499
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| |||||| || |||||||||||||||||||||||||||||    
10540448 aggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagt 10540499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 18549200 - 18549251
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
18549200 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 18549251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 33636321 - 33636372
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
33636321 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 33636372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 364 - 415
Target Start/End: Complemental strand, 38930667 - 38930616
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||| ||||  ||||||||||||||||||||||||||||||    
38930667 taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta 38930616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 1408357 - 1408303
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||  |||||||||||||||||| |||| ||||||||    
1408357 ttaaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt 1408303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 363 - 417
Target Start/End: Original strand, 2355883 - 2355937
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| | |||||||||||||||||| ||| ||||||||||||||    
2355883 ttaaggctaaaatataggtttgatccctgcaaatataccttgttttggttttagt 2355937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 9175010 - 9175068
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||| ||| |||||||||| ||||||||||||||||| |||||    
9175010 aaggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgt 9175068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 18549571 - 18549517
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
18549571 ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgt 18549517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 415
Target Start/End: Original strand, 21125717 - 21125767
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||| |||||  ||||||||||||||||||||||||||||||    
21125717 aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 21125767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 22650462 - 22650520
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
22650462 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 22650520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 421
Target Start/End: Original strand, 23939547 - 23939601
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 421  Q
    |||||||||||||||||| || ||||||||||| |||||||| ||||||||||||    
23939547 ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcct 23939601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 25600599 - 25600541
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||| |||||||||||||| || |||||||||||||| |||||    
25600599 aaggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt 25600541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 25702506 - 25702568
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||| |||||| ||||||||||||||||  ||||||| |||||    
25702506 tttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgt 25702568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 29158669 - 29158619
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| ||||||||||||||  |||||||||||||||||    
29158669 ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagt 29158619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 42430120 - 42430070
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||||||||||||| ||| |||||||||||||    
42430120 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 42430070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 44998263 - 44998213
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||| || |||||||| |||||||||||||||||    
44998263 ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt 44998213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 5357762 - 5357713
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||    
5357762 gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagt 5357713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 369 - 462
Target Start/End: Original strand, 10776150 - 10776243
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||  |||||||||||||| ||||||||||||||| | | |||        || |||||||||||||||||||||| |||||    
10776150 ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaatttttttttttgtttttggtccctgcaaaattttttg 10776243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 13155252 - 13155155
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||  | |||||||||||| ||||||||||||||| | |||||         |||||||||||| ||||||||||||||||||    
13155252 aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaattattgtttttgatccctgcaaaatattttg 13155155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 364 - 417
Target Start/End: Original strand, 14496813 - 14496866
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||  | ||||||||||||| ||||||||||||||||    
14496813 taaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagt 14496866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 23939912 - 23939816
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||| ||||||||||||||||| |||||||||||| |||||||||| |||||| | |||        || ||||||||||||||||||||| ||||||    
23939912 aaggttaaaatatggttttgattcctgcaaatatgactcgttttggctttagtccatgtaatttttgtt-ttgtttttggtccctgcaaaacattttg 23939816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 24187899 - 24187842
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||| ||||  |||||||||||||| ||||||||||||||||| ||||    
24187899 aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg 24187842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 372 - 417
Target Start/End: Original strand, 24814710 - 24814755
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| |||||||||||||||||| |||||||||||||    
24814710 aaatatggttttggtccctgcaaatatgcctcattttggttttagt 24814755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 24815069 - 24815012
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||| ||| ||||||||||||| |||||    
24815069 aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgt 24815012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 415
Target Start/End: Complemental strand, 35345618 - 35345569
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||  | ||||||||||||||||||||||||||||    
35345618 aggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta 35345569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 40492959 - 40493016
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  | |||||||||||| ||||||||||||||||| |||||    
40492959 aggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgt 40493016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 8094478 - 8094534
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  || ||||||||||| ||||||||||||||||| ||||    
8094478 aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg 8094534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  |||||||||||||||||||||||| |||||    
10755528 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta 10755480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 14488714 - 14488766
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| |||||  |||||| |||||||||||||||||||||||||    
14488714 aaggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagt 14488766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 29991913 - 29991965
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||| || |||||||||||||||||||| ||||||||    
29991913 aaggttaaaatatggttttggtctctgcaaatatgcctcgttttagttttagt 29991965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 361 - 413
Target Start/End: Complemental strand, 30337223 - 30337171
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    ||||||||||||||||| |||||  |||||||||||||| |||||||||||||    
30337223 ttttaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt 30337171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 370 - 461
Target Start/End: Original strand, 33652193 - 33652285
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    ||||||||| ||||  ||||||||||||||||||||||| ||||||||| ||||         || |||||||||||||||||||||||||||    
33652193 taaaatatgattttagtccctgcaaatatgcctcgttttagttttagtttctgtaaattttttttgttgtttttggtccctgcaaaatatttt 33652285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  ||||||||||||||| |||||||| ||||||| ||||    
1162909 ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg 1162964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 14495394 - 14495340
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||| ||  |||| |||||||||||||||||||||||||||    
14495394 ttaatgctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagt 14495340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 28258242 - 28258191
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| | | ||||||||||| |||||||||||||||||    
28258242 aggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagt 28258191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 32195280 - 32195375
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| ||||| |||||||| ||| ||||  |||||||  || |        |||||||||||||||||||||||||||||||    
32195280 ggctaaaatatggttttggtccctacaaatatgtctcattttaattttagtctctataattttttttattgtttttggtccctgcaaaatattttg 32195375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 415
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||| ||||||||||| || |||||||||||||||    
36044791 gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta 36044744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 365 - 459
Target Start/End: Original strand, 42429756 - 42429850
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||| ||||| ||||||||||||  |||||||||||| |||||         || |||||||||||||||||||||||||    
42429756 aaggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatatt 42429850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 15719656 - 15719706
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  |||||||||||||  |||||||||||||||||    
15719656 ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagt 15719706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 26530666 - 26530724
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||| ||||||||||||  ||| |||||||||||||| |||| ||||||||||||||    
26530666 aaggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgt 26530724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #152
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 33526052 - 33526102
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||||||||||||| ||| ||||||||||||    
33526052 ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt 33526102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #153
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 40844537 - 40844479
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||  |||||||||||||  ||||||||||||||||| |||||    
40844537 aaggttaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgt 40844479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 43727097 - 43727151
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  ||||||||||||||| | |||||| |||||||||||||    
43727097 ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgt 43727151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #155
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 28399036 - 28398979
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||  ||||||||||||||  |||||||||||||||| |||||    
28399036 aggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgt 28398979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #156
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt 412  Q
    ||||||||| |||||||  |||||||||||||||||||||||||||    
40493157 ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt 40493112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 1408005 - 1408061
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||| |||||||||| |||||||| ||||||| ||||||    
1408005 ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcctgt 1408061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 403
Target Start/End: Complemental strand, 30969717 - 30969681
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctc 403  Q
    |||||||||||||||||| ||||||||||||||||||    
30969717 ggctaaaatatggttttggtccctgcaaatatgcctc 30969681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 366 - 414
Target Start/End: Complemental strand, 35115640 - 35115592
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||||||||  ||||| ||||||| |||||||||||||||    
35115640 aggctaaaatatggttttagtccctacaaatatacctcgttttggtttt 35115592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #160
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 2356245 - 2356198
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||| ||||||| | |||||||||| |||||||||||||||||    
2356245 taaaatatgattttgattcatgcaaatatgtctcgttttggttttagt 2356198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #161
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 4376011 - 4375961
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||| ||| ||||||||||||    
4376011 aggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagt 4375961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #162
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 15930933 - 15930988
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| ||||| | ||| |||||||| ||||||||||||||||| |||||    
15930933 gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgt 15930988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #163
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 27341257 - 27341308
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |  ||||||||||||||| |||||| |||||||    
27341257 aggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagt 27341308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #164
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 30969399 - 30969454
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||| | ||||||||  |||||||||||||||| |||||    
30969399 gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgt 30969454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 1163274 - 1163224
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||| |||||||||||| |||||| ||||||||    
1163274 ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagt 1163224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 409
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttg 409  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||    
9908918 ggctaaaatatagttttaatccctgcaaatatgtctcgttttg 9908960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 408
Target Start/End: Complemental strand, 25702810 - 25702768
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgtttt 408  Q
    ||||||||||||||||||| |||||||||||||| ||| ||||    
25702810 aggctaaaatatggttttggtccctgcaaatatgtctcatttt 25702768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 29487750 - 29487800
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| ||||  ||||||||||||||  ||||||||||||||||    
29487750 ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagt 29487800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 32040069 - 32040131
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||| | ||  ||||||||||||||  |||||||||||||||| |||||    
32040069 tttttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgt 32040131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 6469668 - 6469611
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||| || |||||||||||   ||||||||||||||| |||||    
6469668 aggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgt 6469611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #171
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 7578527 - 7578478
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||| |||||| || |||||||||||| ||| |||||||||||||    
7578527 gctaaaatacggttttaattcctgcaaatatgactcattttggttttagt 7578478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #172
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 19962994 - 19963051
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| ||  ||| |||||||||| |||||||| |||||||| |||||    
19962994 aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgt 19963051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #173
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 21126022 - 21125965
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||||  ||| || ||||||| ||||||||||||||||| |||||    
21126022 aggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgt 21125965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #174
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 365 - 398
Target Start/End: Complemental strand, 22534783 - 22534750
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatat 398  Q
    |||||||||||||| |||||||||||||||||||    
22534783 aaggctaaaatatgcttttgatccctgcaaatat 22534750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #175
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 393 - 422
Target Start/End: Original strand, 24954697 - 24954726
Alignment:
393 aaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||||||||||    
24954697 aaatatgcctcgttttggttttagttcctg 24954726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #176
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 379 - 415
Target Start/End: Complemental strand, 1778917 - 1778881
Alignment:
379 gttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||| |||||||||||||| |||||||||||||||    
1778917 gttttggtccctgcaaatatgtctcgttttggtttta 1778881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #177
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Original strand, 22270942 - 22270974
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||| |||||||||||||||||||    
22270942 aggctaaaatatgcttttgatccctgcaaatat 22270974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #178
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 403
Target Start/End: Original strand, 28398756 - 28398792
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctc 403  Q
    |||||||||||||||||  ||||||||||||||||||    
28398756 ggctaaaatatggttttagtccctgcaaatatgcctc 28398792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #179
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 386 - 414
Target Start/End: Complemental strand, 42430041 - 42430013
Alignment:
386 tccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||||||||||||||    
42430041 tccctgcaaatatgcctcgttttggtttt 42430013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #180
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 43727431 - 43727384
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||  ||| |||||||||| |||||||||||||||||    
43727431 ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagt 43727384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 58; Significance: 3e-24; HSPs: 167)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 28872000 - 28871900
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattt 460  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||        |||||||||||||| ||||||||||| ||    
28872000 ttttaaggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaaagaaatttattgtttttggt-cctgcaaaataatt 28871902  T
461 tg 462  Q
    ||    
28871901 tg 28871900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 26071618 - 26071521
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||| ||||||||| |||||||||||||||||||| ||||||||||||||||| |||||        || ||||||||||||||||||||||||||||    
26071618 aaggttaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaatttttgtttttgtttttggtccctgcaaaatattttg 26071521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 362 - 422
Target Start/End: Original strand, 40764410 - 40764470
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
40764410 tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 40764470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 363 - 422
Target Start/End: Complemental strand, 1381615 - 1381556
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
1381615 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1381556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 363 - 422
Target Start/End: Complemental strand, 5917464 - 5917405
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
5917464 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5917405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 365 - 459
Target Start/End: Complemental strand, 19685382 - 19685287
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
19685382 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 19685287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 29366949 - 29366854
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||||||||        |||| |||||||||||||||||||| |||||    
29366949 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaattttttttatagtttttggtccctgcaaaattttttg 29366854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 1381245 - 1381343
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
1381245 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 1381343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 5614536 - 5614474
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
5614536 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 5614474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 459
Target Start/End: Original strand, 21124911 - 21125005
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    ||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||          ||||||||||||||||||||||||||    
21124911 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtccctgcaaaatatt 21125005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 366 - 459
Target Start/End: Complemental strand, 24443745 - 24443651
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
24443745 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 24443651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 38170512 - 38170570
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
38170512 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 38170570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 40764782 - 40764684
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
40764782 aaggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaaatattttg 40764684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 35928062 - 35928119
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
35928062 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35928119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 1105149 - 1105093
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
1105149 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1105093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 19565832 - 19565776
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
19565832 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 19565776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 20660946 - 20660998
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||    
20660946 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 20660998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 30800851 - 30800756
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||        || |||||||||||||||||||||| |||||    
30800851 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttt-ttgtttttggtccctgcaaaattttttg 30800756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 35928458 - 35928362
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
35928458 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 35928362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 360 - 423
Target Start/End: Original strand, 45131 - 45194
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
45131 gttttatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 45194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
6912497 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 6912552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 360 - 423
Target Start/End: Original strand, 29692737 - 29692800
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
29692737 gtttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 29692800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 2217492 - 2217550
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
2217492 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 2217550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 363 - 417
Target Start/End: Original strand, 4203452 - 4203506
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
4203452 ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 4203506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 5950170 - 5950232
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
5950170 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 5950232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 7075570 - 7075628
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
7075570 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 7075628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 19565465 - 19565563
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
19565465 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 19565563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 20986091 - 20985993
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||          || ||||||||||||||||||||||||||||    
20986091 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 20985993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 24443377 - 24443435
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||    
24443377 taaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 24443435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 28863508 - 28863566
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
28863508 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 28863566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 29151854 - 29151796
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  | |||||||||||||||||||||||||||||||||||    
29151854 taaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg 29151796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 29172889 - 29172831
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
29172889 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29172831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 29875397 - 29875455
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||    
29875397 taaggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg 29875455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 36578085 - 36578027
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
36578085 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 36578027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 366 - 459
Target Start/End: Original strand, 37271358 - 37271452
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    ||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
37271358 aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 37271452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 1104857 - 1104914
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||    
1104857 aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgt 1104914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 2636992 - 2636943
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||    
2636992 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 2636943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 4736547 - 4736486
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||| ||||||||||||||  |||||||||||||||| |||||    
4736547 tttaaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt 4736486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 5917125 - 5917222
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
5917125 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 5917222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 16038375 - 16038472
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| | |||          ||||||||||||||||||||||| |||||    
16038375 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaattgtttttggtccctgcaaaattttttg 16038472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 18633597 - 18633654
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
18633597 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 18633654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 422
Target Start/End: Complemental strand, 29875731 - 29875670
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
29875731 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29875670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 30800493 - 30800550
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
30800493 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 30800550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 35167167 - 35167110
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
35167167 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 35167110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 35876686 - 35876743
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
35876686 aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 35876743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 35877053 - 35876956
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||  |||||         || ||||||||||||||||||||||||||||    
35877053 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 35876956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 40038493 - 40038542
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||    
40038493 aggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta 40038542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 42596448 - 42596509
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||||||| ||||||||  || ||||||||||||||||||||    
42596448 tttaaggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgt 42596509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 10743722 - 10743774
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
10743722 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 10743774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 18258529 - 18258477
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| |||||||||||||| |||||||||||||||||    
18258529 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 18258477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 19685016 - 19685072
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
19685016 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19685072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 454
Target Start/End: Original strand, 20690732 - 20690820
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaa 454  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||  ||||        || ||||||||||||||||||||    
20690732 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaatttttttttttgtttttggtccctgcaaa 20690820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
20985728 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 20985780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 28213371 - 28213423
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| |||||||||||||||||| |||||||||||||    
28213371 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt 28213423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
28550827 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 28550883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 28863838 - 28863782
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
28863838 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 28863782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 30888160 - 30888216
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
30888160 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 30888216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 369 - 421
Target Start/End: Complemental strand, 35609635 - 35609583
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 421  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||||||    
35609635 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcct 35609583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 40029497 - 40029441
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
40029497 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 40029441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 2217855 - 2217804
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
2217855 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 2217804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 362 - 417
Target Start/End: Complemental strand, 13990900 - 13990845
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| ||||||  ||||||||||||||||||||||||||||||||    
13990900 tttaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 13990845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 18046349 - 18046298
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
18046349 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 18046298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 370 - 461
Target Start/End: Complemental strand, 28108159 - 28108069
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||        || ||||||||||||||| |||||||||||    
28108159 taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgtaattttgttt-ttgtttttggtcccttcaaaatatttt 28108069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 6912855 - 6912801
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
6912855 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 6912801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 15635710 - 15635652
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||| ||||||||||||||||||||||||||| ||||    
15635710 taaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 15635652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 18258159 - 18258217
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||    
18258159 taaggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg 18258217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 26133415 - 26133357
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
26133415 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 26133357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 368 - 422
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
29172524 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29172578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 362 - 416
Target Start/End: Original strand, 35166906 - 35166960
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    ||||||||||||||||||||||  ||||||||||||||||| |||||||||||||    
35166906 tttaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag 35166960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 38786157 - 38786215
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
38786157 aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 38786215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 40167784 - 40167842
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| |||||||||  |||||||||||||||||||||||||||||||| |||||    
40167784 aaggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 40167842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 5904007 - 5904064
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| ||| |||||||||||||||||||| ||||||| |||||    
5904007 aggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgt 5904064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 10408926 - 10408983
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
10408926 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 10408983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 10830528 - 10830585
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| || || ||||||||||| ||||||||||||||||||||    
10830528 aggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgt 10830585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 11799459 - 11799402
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
11799459 aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgt 11799402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 459
Target Start/End: Complemental strand, 20661311 - 20661218
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||| ||| ||||||||||| |||||||||||||||| |||||         || |||||||||||||||||||||||||    
20661311 ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatatt 20661218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 23381949 - 23382006
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| || ||||||||||||||||||||    
23381949 aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt 23382006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 415
Target Start/End: Complemental strand, 25562000 - 25561951
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||    
25562000 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 25561951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 25779163 - 25779106
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||||||||||||||| || |||||||||||||||||||    
25779163 aggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgt 25779106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 26133178 - 26133239
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| |||||||||||||||||  ||||| |||||||||||||||||||||||||| |||||    
26133178 tttatggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 26133239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 36577721 - 36577778
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
36577721 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 36577778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 37271708 - 37271651
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||    
37271708 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg 37271651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 38554750 - 38554844
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||  ||||        || ||||||||||| | ||||||||||||||    
38554750 aggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtctctgtaaatttttttgttgtttttggttcatgcaaaatattttg 38554844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 293826 - 293878
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||||||||||||| |||||||    
293826 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt 293878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 1286682 - 1286738
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||| ||||| |||||||||||||||||||||||||| |||||    
1286682 ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgt 1286738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 6118499 - 6118451
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
6118499 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 6118451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 10409332 - 10409276
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||| |||||||    
10409332 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt 10409276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 458
Target Start/End: Original strand, 12144906 - 12144998
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatat 458  Q
    ||||||||||||||||||  |||||| ||||||||||| ||||||||||||| |||||         | ||||||||||||||||||||||||    
12144906 aggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgtatttttttgttttgtttttggtccctgcaaaatat 12144998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
18633961 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 18633913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 27916766 - 27916714
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||  ||||||||||||||||||||||||||||||||    
27916766 aaggttaaaatatggttttattccctgcaaatatgcctcgttttggttttagt 27916714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 33336026 - 33335970
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
33336026 ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt 33335970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 34125301 - 34125357
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| |||||||||||| |||||  ||||||||||||||||||||||||||||||||    
34125301 tttttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 34125357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 35609303 - 35609359
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||| ||||||||||| |||||||||||||||| |||||    
35609303 ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgt 35609359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 36973710 - 36973614
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||| ||||||| ||||||||| ||||||| |||||         || ||||||||||||||||||||||||||||    
36973710 ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 36973614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 40038858 - 40038762
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||| ||||| ||||||||||||||||| |||||||||||| | |||||         || ||||||||||||||||||||||||||||    
40038858 ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 40038762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 18286744 - 18286685
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| ||||||||  ||||||||||||| ||||||||||||||||||| ||||    
18286744 taaggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagttactgt 18286685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  ||||||||||||||| |||||||||||||||| ||||    
25561705 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg 25561760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 34125635 - 34125576
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||  |||||| ||||||||||| ||||||||||||| |||||    
34125635 taaggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt 34125576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 39379611 - 39379560
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
39379611 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 39379560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 1287047 - 1286989
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||| |||||| ||||||| ||| |||||||||||||||||||    
1287047 aaggttaaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgt 1286989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 2636669 - 2636719
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||||||||||| | |||||||||||||||||    
2636669 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt 2636719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 415
Target Start/End: Complemental strand, 9179922 - 9179872
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||  ||| ||||||||||||||||||||||||||    
9179922 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta 9179872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 18046036 - 18046094
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
18046036 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 18046094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 20683741 - 20683803
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||  || |||||||||||| |||||||| ||||||| |||||    
20683741 ttttaaggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgt 20683803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 23382297 - 23382247
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||||||||||||||| ||||||||||||||    
23382297 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 23382247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 366 - 412
Target Start/End: Original strand, 31602142 - 31602188
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt 412  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||    
31602142 aggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt 31602188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 38496785 - 38496727
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  ||||||||||||||  |||||||||||||||| ||||    
38496785 taaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 38496727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 42553642 - 42553692
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| ||||| |||||||||||||| |||||||||||||||||    
42553642 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 42553692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 4203771 - 4203714
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
4203771 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 4203714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 10744055 - 10743998
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||| |||||||||| ||||||||||||||||| |||||    
10744055 aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt 10743998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 11799127 - 11799184
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  ||||||||||||||| | |||||||||||||| ||||    
11799127 aaggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg 11799184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 24781988 - 24782045
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  || ||||||||||| ||||||||||||||||| |||||    
24781988 aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt 24782045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 415
Target Start/End: Complemental strand, 31037742 - 31037693
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||    
31037742 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 31037693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 362 - 415
Target Start/End: Original strand, 40029136 - 40029189
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||  |||||| ||||||| |||||||||||||||    
40029136 tttaaggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta 40029189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 42596814 - 42596761
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| |||||||||||||| |||||||| |||||||| |||||    
42596814 taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt 42596761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 3850600 - 3850544
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||| ||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
3850600 aggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 3850544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 5104001 - 5103945
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| | |||||||||||| ||| |||||||||||||| ||||    
5104001 ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagtttctgt 5103945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 5614164 - 5614216
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| |||||||    
5614164 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 5614216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 9532537 - 9532485
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||  ||| ||||||||||||||||||||||||||||    
9532537 aaggttaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 9532485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 14318039 - 14318095
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||||||  ||| |||||||||| |||||||||||||||||    
14318039 tttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 14318095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 16038738 - 16038690
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||| ||||  ||||||||||||||||||||||||||||||||    
16038738 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 16038690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 21050913 - 21050857
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||| |||||||| ||||||| |||||    
21050913 ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgt 21050857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 29693092 - 29693040
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||  ||||||||||||||| ||||||||||||||||    
29693092 aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt 29693040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 454
Target Start/End: Original strand, 32108807 - 32108895
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaa 454  Q
    ||||||||||||||||||| ||||||||||||||  ||||||| |||||| | |||||        || ||||||||||||||||||||    
32108807 aggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgtaaaaaaaattgttgtttttggtccctgcaaa 32108895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 371 - 423
Target Start/End: Original strand, 32888691 - 32888743
Alignment:
371 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||||||||||| ||||||||| |||||||| |||||    
32888691 aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgt 32888743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 36278075 - 36278131
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||||||||||||||||||||||  || |||| ||||||||    
36278075 tttttaggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagt 36278131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 419
Target Start/End: Original strand, 36973353 - 36973405
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||||| || || |||||||| |||||||||||||||||||    
36973353 ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttc 36973405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 419
Target Start/End: Original strand, 38962806 - 38962858
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||||  |||||| ||||||| |||||||||||||||||||    
38962806 ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttc 38962858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||| ||||  |||||||||||||||||||||||||||||||| ||||    
39379242 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 39379294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 414
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||  ||||||||||| |||||||||||||||||    
3850299 ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt 3850346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||| ||||  |||||||||||||||||||||||| ||||||| ||||    
29151516 ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg 29151571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 38555084 - 38555034
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| | |||||||||||||||||| |||||||||||||    
38555084 aggctaaaatatggtttgg-tccctgcaaatatgcctcattttggttttagt 38555034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 2032940 - 2032890
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||| |||||||||  |||||||||||||| |||||||||||||||||    
2032940 ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagt 2032890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 15916286 - 15916336
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||| ||||||||| |||||||||||||| ||| |||||||||||||    
15916286 ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagt 15916336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 407
Target Start/End: Original strand, 17070533 - 17070575
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttt 407  Q
    |||||||||||||||||||| |||||||||||||| |||||||    
17070533 aaggctaaaatatggttttggtccctgcaaatatgtctcgttt 17070575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 413
Target Start/End: Original strand, 20416356 - 20416406
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||||||  |||||||||||||| |||| ||||||||    
20416356 ttaaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt 20416406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 415
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||| |||||||||||||| ||||||||| |||||    
38452394 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta 38452348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 421
Target Start/End: Original strand, 42994068 - 42994122
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 421  Q
    |||||||||||||||||  |||||||||||||| ||||||||| ||||| |||||    
42994068 ggctaaaatatggttttagtccctgcaaatatgactcgttttgattttaattcct 42994122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 415
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||| ||||||||||||||  ||||||||||||||    
45501 taaaatatggttttggtccctgcaaatatgtttcgttttggtttta 45456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 9179592 - 9179649
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||| ||||||||||  |||||||||||||||| |||||    
9179592 aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgt 9179649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 369 - 414
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||| |||||||||||||| ||||||||| ||||    
12145181 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt 12145136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 15635370 - 15635431
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||| ||||||||||||||  ||| |||||||||| || |||||||||||||| ||||    
15635370 ttttaaggataaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg 15635431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 26071290 - 26071347
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||| | |||||||||||||| ||| ||||||||||||| |||||    
26071290 aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgt 26071347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 423
Target Start/End: Original strand, 28871640 - 28871693
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| ||||| ||||||||||||| | |||||||||||||||| |||||    
28871640 taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgt 28871693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 40168009 - 40167952
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||||  ||| |||||||||| ||||||||||||||||| |||||    
40168009 aggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgt 40167952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 42207241 - 42207298
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||| || ||||||| ||||||||||||||||| |||||    
42207241 aggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgt 42207298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 16616370 - 16616418
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||  |||||||||||||||||| |||| ||||||||    
16616370 ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt 16616418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 20691094 - 20691046
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||| ||||| | |||||||||||| |||||||||||||||||    
20691094 ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagt 20691046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 35166159 - 35166103
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||| |||||||||||  |||||||||| ||| ||||||||||||||||| ||||    
35166159 aggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg 35166103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #150
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 413
Target Start/End: Complemental strand, 38182089 - 38182041
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||||| |  ||||||||||| |||||||||||||    
38182089 aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38182041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 413
Target Start/End: Original strand, 38189042 - 38189090
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||||| |  ||||||||||| |||||||||||||    
38189042 aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38189090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 413
Target Start/End: Complemental strand, 38209315 - 38209267
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||||| |  ||||||||||| |||||||||||||    
38209315 aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38209267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 413
Target Start/End: Original strand, 38216267 - 38216315
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||||| |  ||||||||||| |||||||||||||    
38216267 aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38216315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 42207576 - 42207517
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| |||||||||||||||  ||| | |||||||||||||||||||||||||| |||||    
42207576 ttaagcctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt 42207517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #155
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 5 - 68
Target Start/End: Complemental strand, 26204243 - 26204180
Alignment:
5 agtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatga 68  Q
    |||||||||||||||||||||   || ||| | ||||||||||||||||||||| |||| ||||    
26204243 agtttggtgttcagatcaatgattgaagtgcctatgattatttggtgtggtttacaacaaatga 26204180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #156
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 29855614 - 29855669
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| ||||| ||| || ||||||||||| ||||||||||||| |||||    
29855614 gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgt 29855669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #157
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 362 - 417
Target Start/End: Original strand, 31037390 - 31037445
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| |||||||||||||||  ||||||||||||| ||| |||||| |||||||    
31037390 tttaagactaaaatatggttttagtccctgcaaatataccttgttttgattttagt 31037445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 9588611 - 9588561
Alignment:
368 gctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| |||| | |||||||||||||| |||||||||||||||||    
9588611 gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt 9588561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 416
Target Start/End: Complemental strand, 17070864 - 17070814
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    ||||||||||||||||||  ||||| |||||||| |||||||| |||||||    
17070864 aggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag 17070814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 414
Target Start/End: Original strand, 28213446 - 28213480
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||| |||||||||||||||||||||||||||||    
28213446 ttttggtccctgcaaatatgcctcgttttggtttt 28213480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #161
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 3851330 - 3851273
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||  ||||||| ||||||||| ||||||| |||||    
3851330 aggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgt 3851273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #162
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 411
Target Start/End: Original strand, 4736204 - 4736249
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggt 411  Q
    ||||||||||||||||||| ||  |||||||||| |||||||||||    
4736204 aggctaaaatatggttttggtctttgcaaatatgtctcgttttggt 4736249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #163
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 380 - 417
Target Start/End: Original strand, 31602221 - 31602258
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||| |||||||||||||| |||||||||||||||||    
31602221 ttttggtccctgcaaatatgtctcgttttggttttagt 31602258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #164
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 410
Target Start/End: Original strand, 7085477 - 7085520
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttgg 410  Q
    ||||||||||||||||||| |||||| |||||||||| |||||||    
7085477 aggctaaaatatggttttg-tccctgtaaatatgccttgttttgg 7085520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #165
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 10830898 - 10830846
Alignment:
366 aggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| |||| | |||||||||||||||||  |||||||||||||    
10830898 aggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagt 10830846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #166
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 21050575 - 21050631
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||  ||||| ||||||||| |||||||| ||||||| |||||    
21050575 ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgt 21050631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #167
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 27850372 - 27850324
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||| ||||  || ||||||||||| |||||||||||||||||    
27850372 ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagt 27850324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 182)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 1614906 - 1614808
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
1614906 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 1614808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 9659691 - 9659593
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
9659691 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 9659593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 45228921 - 45228862
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
45228921 taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 45228862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 3975547 - 3975605
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
3975547 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 3975605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 5354762 - 5354864
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
5354762 tttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 5354861  T
460 ttg 462  Q
    |||    
5354862 ttg 5354864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 366 - 460
Target Start/End: Complemental strand, 12932784 - 12932690
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattt 460  Q
    ||||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||        || ||||||||||||||||||||||||||    
12932784 aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaatttgttgtttttggtccctgcaaaatattt 12932690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 44568692 - 44568594
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
44568692 aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 44568594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 22539929 - 22539986
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||    
22539929 aggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt 22539986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 23399606 - 23399667
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
23399606 tttttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23399667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 25988751 - 25988694
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
25988751 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25988694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 29198663 - 29198566
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
29198663 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 29198566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 8144659 - 8144603
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
8144659 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8144603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 16853589 - 16853533
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
16853589 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 16853533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 23676453 - 23676397
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
23676453 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23676397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 26878072 - 26878016
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
26878072 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 26878016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 370 - 454
Target Start/End: Original strand, 44841359 - 44841443
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaa 454  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||| |||||        || ||||||||||||||||||||    
44841359 taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgtaattttttttgttgtttttggtccctgcaaa 44841443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 363 - 462
Target Start/End: Original strand, 46828940 - 46829040
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    |||||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||         || |||||||||||||||||||||||||||    
46828940 ttaaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatatttt 46829039  T
462 g 462  Q
    |    
46829040 g 46829040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 48192489 - 48192433
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
48192489 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 48192433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 3975839 - 3975788
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
3975839 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 3975788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 13770084 - 13770025
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||  |||||||||||||||| |||||||||||||||||||||    
13770084 taaggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgt 13770025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 365 - 463
Target Start/End: Complemental strand, 28911908 - 28911812
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttga 463  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||          ||||||||||||||||||||||| ||||||    
28911908 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa--attgtttttggtccctgcaaaattttttga 28911812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 462
Target Start/End: Original strand, 41053839 - 41053938
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||||| |||||||||||||||||| ||||| ||||||| |||||         || ||||||||||||||||||||||||||||    
41053839 taaggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 41053938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 5234206 - 5234108
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
5234206 aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 5234108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 8144293 - 8144391
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
8144293 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 8144391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 12894404 - 12894346
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
12894404 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 12894346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 19757746 - 19757804
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
19757746 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 19757804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 25092550 - 25092452
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||          || ||||||||||||||||||||||||||||    
25092550 aaggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 25092452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 26877675 - 26877733
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||    
26877675 taaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg 26877733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 27037587 - 27037689
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    ||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||          || |||||||||||||||||||||||||    
27037587 ttttatggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatt 27037686  T
460 ttg 462  Q
    |||    
27037687 ttg 27037689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 27458397 - 27458455
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
27458397 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 27458455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 461
Target Start/End: Complemental strand, 30223798 - 30223700
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    ||||||||||||||||||||| ||| |||||||||||||||||||||||||||| | |||         || |||||||||||||||||||||||||||    
30223798 taaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatatttt 30223700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 415
Target Start/End: Complemental strand, 34878127 - 34878077
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||    
34878127 aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta 34878077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 35838343 - 35838281
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
35838343 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 35838281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 37372906 - 37372848
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
37372906 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgt 37372848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 41054242 - 41054180
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||    
41054242 tttttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 41054180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 48854072 - 48853974
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||| ||||||||||||||||||||  |||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
48854072 aaggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 48853974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 5233806 - 5233863
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
5233806 aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 5233863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 6108332 - 6108389
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
6108332 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 6108389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 17999722 - 17999665
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
17999722 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 17999665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 23399978 - 23399921
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
23399978 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 23399921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 25092158 - 25092215
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
25092158 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25092215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 370 - 419
Target Start/End: Original strand, 25547256 - 25547305
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||    
25547256 taaaatatggttttaatccctgcaaatatgcctcgttttggttttagttc 25547305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 25988384 - 25988481
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
25988384 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 25988481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 35104296 - 35104239
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||    
35104296 aggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 35104239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 35470281 - 35470224
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||    
35470281 aggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgt 35470224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 35665876 - 35665933
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||    
35665876 aggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgt 35665933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 364 - 417
Target Start/End: Original strand, 35837921 - 35837974
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
35837921 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35837974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 44509056 - 44508999
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
44509056 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 44508999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 48192255 - 48192312
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
48192255 aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 48192312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 1614558 - 1614614
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
1614558 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1614614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 419
Target Start/End: Original strand, 19561154 - 19561206
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||||    
19561154 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc 19561206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 461
Target Start/End: Original strand, 28262712 - 28262808
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    ||||||||||||||||||| |||||||||||||||||| ||||||||||| | |||||         || |||||||||||||||||||||||||||    
28262712 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaaaaaaagttgttgtttttggtccctgcaaaatatttt 28262808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 35469880 - 35469976
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||  ||||         || ||||||||||||||||||||||||||||    
35469880 ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaaaatttttttgttgtttttggtccctgcaaaatattttg 35469976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 46759652 - 46759708
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
46759652 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 46759708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 46829312 - 46829256
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||    
46829312 ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgt 46829256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 48852442 - 48852494
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| ||||||||||||||||||||||| ||||||||    
48852442 aaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagt 48852494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
1006835 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 1006890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 368 - 466
Target Start/End: Original strand, 6079810 - 6079906
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttgatcc 466  Q
    ||||||||||||||||  |||||||||||||||||||||||| ||||||| |||||          ||||||||||||||||||||||| |||||||||    
6079810 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaa--attgtttttggtccctgcaaaattttttgatcc 6079906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 414
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||    
6589021 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 6589068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 38486791 - 38486740
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||||| ||||||||| |||||||||||||||    
38486791 aggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagt 38486740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 39438740 - 39438791
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| |||||| |||||||||||||||||||||||||    
39438740 aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt 39438791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
44508720 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 44508775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 2945847 - 2945789
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||| ||||| |||||||||||||||||||||||||| |||||    
2945847 aaggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgt 2945789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 6509206 - 6509264
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||||||||||| |||||||| |||||    
6509206 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgt 6509264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 6509472 - 6509414
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||| |||||||||||||||||||||||||| |||||    
6509472 aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 6509414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 7431951 - 7432001
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||    
7431951 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 7432001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 415
Target Start/End: Complemental strand, 8555801 - 8555751
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||    
8555801 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 8555751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 11767281 - 11767219
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||| ||||||||||||||| || ||||||||||||| |||||    
11767281 tttttaggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgt 11767219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 16940760 - 16940818
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||| ||||||||||| ||||||||||||||||||| |||||||||||| |||||    
16940760 aaggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgt 16940818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 35210176 - 35210238
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||| |||||||||| ||||||||| ||||||||||||||||| |||||    
35210176 tttttaggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt 35210238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 44344791 - 44344733
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
44344791 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 44344733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 44402954 - 44403016
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||  |||||||||||||||| | ||||||||||||| |||||    
44402954 ttttaaggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgt 44403016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 44568323 - 44568381
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||| |||||||||||||  ||||||||||||||||| ||||    
44568323 taaggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg 44568381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 45073643 - 45073585
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||  |||||||||||||||||||||||||||||||| |||||    
45073643 aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt 45073585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 3807863 - 3807920
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||||| | |||||||||||| |||||||||||||||||||||||    
3807863 aggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgt 3807920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 16941049 - 16940996
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| |||||||||||||||||| ||||||||||||| |||||    
16941049 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 16940996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 5 - 110
Target Start/End: Original strand, 18044460 - 18044565
Alignment:
5 agtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtgtgt 104  Q
    |||||| |||||| ||||||| | || |||||||||||||||||||||| |||| ||||||||| || |  || |||||||| ||| || || |||||||    
18044460 agtttgatgttcatatcaatgactgaagtgtccatgattatttggtgtgatttacaacatatgaaaataggcacgctaatttgtagtagtttttgtgtgt 18044559  T
105 cgtgga 110  Q
    ||||||    
18044560 cgtgga 18044565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 20388273 - 20388330
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||||||||||||||||| |||||||||||||| |||||    
20388273 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 20388330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 28911576 - 28911633
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||||||||||||||||||||||| |||||||| |||||    
28911576 aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgt 28911633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 30223459 - 30223516
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||| ||||||||| ||||||||||||||||| ||||    
30223459 aaggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg 30223516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 35015221 - 35015124
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct-gtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||| ||        || |||||||||||||||||||||| |||||    
35015221 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttg 35015124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 39439031 - 39438974
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||| | ||||||||||||||||| ||||    
39439031 aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 39438974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 39832905 - 39832962
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
39832905 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 39832962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 419
Target Start/End: Complemental strand, 45021857 - 45021804
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    ||||||||||||||||||  |||||||||||||||||| |||||||||||||||    
45021857 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttc 45021804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 6589276 - 6589224
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||| ||||||||||||||||| ||||||||||||||    
6589276 aaggttaaaatatggttttggtccctgcaaatatgccttgttttggttttagt 6589224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 6847117 - 6847069
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||||||    
6847117 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt 6847069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 9659354 - 9659410
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||    
9659354 aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 9659410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 10358368 - 10358312
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
10358368 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 10358312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 414
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||||| |||||||||||||||||||||||||||||    
11766920 taaaatatggttttggtccctgcaaatatgcctcgttttggtttt 11766964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 14543708 - 14543760
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| |||||||||||||| ||| |||||||||||||    
14543708 aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 14543760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 17999465 - 17999521
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||| || |||||    
17999465 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgt 17999521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 19561450 - 19561394
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
19561450 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 19561394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 21223750 - 21223698
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||| ||||||||||||||||||    
21223750 aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt 21223698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 21554754 - 21554658
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||  ||||||||||||||||| |||||| ||||||| |||||          ||||||||||||||||||||||| |||||    
21554754 aggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttg 21554658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
23676135 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 23676187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 29198302 - 29198358
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||  ||||||||||||||||| ||||    
29198302 aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg 29198358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 35210515 - 35210459
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
35210515 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 35210459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 39833236 - 39833180
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  | |||||||||||||||||||||||||||||| |||||    
39833236 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt 39833180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 46759942 - 46759886
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||    
46759942 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgt 46759886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 419
Target Start/End: Complemental strand, 48359075 - 48359023
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||||    
48359075 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttc 48359023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 376 - 423
Target Start/End: Complemental strand, 1271590 - 1271543
Alignment:
376 atggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| |||||||||||||||||||||||||||||||| |||||    
1271590 atggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 1271543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 5355114 - 5355067
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||    
5355114 taaagtatggttttggtccctgcaaatatgcctcgttttggttttagt 5355067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 18022705 - 18022654
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| ||||  ||||||||||||||||||||||||||||||||    
18022705 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 18022654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 23816669 - 23816720
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
23816669 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt 23816720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 365 - 416
Target Start/End: Original strand, 38186364 - 38186415
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||| ||||||||||||||| |||||||||||||||||||||||| ||||||    
38186364 aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgattttag 38186415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 364 - 462
Target Start/End: Complemental strand, 39520733 - 39520634
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||| ||||||||||||||| ||| |||||||||| ||||||||| ||||||| |||||         || ||||||||||||||||||||||||||||    
39520733 taaggttaaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 39520634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 1559707 - 1559649
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||  ||||||| |||||    
1559707 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgt 1559649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 13769774 - 13769824
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
13769774 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 13769824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 363 - 413
Target Start/End: Complemental strand, 31310683 - 31310633
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||||||  ||||||||||||||| ||||||||||||    
31310683 ttaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt 31310633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 32189388 - 32189334
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  || ||||||||||||||||||||||||||||| |||||    
32189388 ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt 32189334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 39520396 - 39520454
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| ||| | |||||||| ||||||||||||||||| |||||    
39520396 aaggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgt 39520454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 44958508 - 44958450
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||| ||||| |||||||| ||||||||||||||||| |||||    
44958508 aaggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgt 44958450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 45021488 - 45021550
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgtttt-ggttttagttcctg 422  Q
    ||||| |||||||||||||||||  ||||||||||||||||||||||| ||||||||| ||||    
45021488 ttttatggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg 45021550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 415
Target Start/End: Original strand, 45073308 - 45073362
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||| ||||||||||||||||||  |||||||||||| |||||||||||||||||    
45073308 tttttaggctaaaatatggttttagtccctgcaaataagcctcgttttggtttta 45073362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 415
Target Start/End: Complemental strand, 46648717 - 46648667
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||  || |||||||||||||||||||||||||||    
46648717 aaggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta 46648667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 10358000 - 10358057
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| | ||  |||||||||||||||||||||||||||||||| |||||    
10358000 aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgt 10358057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 14739006 - 14738949
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  ||||||||||||||| |||||||| ||||||| ||||    
14739006 aaggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg 14738949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 368 - 421
Target Start/End: Original strand, 18022368 - 18022421
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 421  Q
    ||||||||||||||||  |||| ||||||||| |||||||||||||||||||||    
18022368 gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcct 18022421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 20388680 - 20388619
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| |||||||||||||||||  || ||| ||||||||||||||||| |||||||||||||    
20388680 tttatggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgt 20388619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 30352558 - 30352615
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||  |||||||||||||||||||||||||||| ||| ||||    
30352558 aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg 30352615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 35104076 - 35104133
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||  ||||| |||||||||||||| ||||||||||||||||| ||||    
35104076 aaggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg 35104133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 38186767 - 38186710
Alignment:
361 ttttaaggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||| | |||||||||||||| |||||||||||||||||    
38186767 ttttaaggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt 38186710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 39719643 - 39719586
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| |||||||| |||||||| |||||    
39719643 aggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgt 39719586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 363 - 415
Target Start/End: Original strand, 1559339 - 1559391
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||| |||||  |||||||||||||||||||||||| |||||    
1559339 ttaaggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta 1559391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 1974009 - 1974065
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||  |||||||||||||||| |||||    
1974009 ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 1974065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||| | ||||||||||| ||||||||||||||||    
6911247 ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta 6911199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 21223399 - 21223455
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||| |||||||||||| ||||  ||||||||||||||| ||||||||||||||||    
21223399 ttttagggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt 21223455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 25547490 - 25547434
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
25547490 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 25547434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 415
Target Start/End: Original strand, 31732101 - 31732149
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  |||||||||||||||||||||||| |||||    
31732101 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta 31732149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 371 - 423
Target Start/End: Original strand, 37372441 - 37372493
Alignment:
371 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
37372441 aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 37372493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||| || |||||||| ||||||||||||||||| |||||    
41364884 ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt 41364940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 45228614 - 45228670
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  ||| |||||||||||||||||| |||||||| ||||    
45228614 aggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg 45228670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 46304084 - 46304136
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||  | ||||||||||||||||||||||||||||||    
46304084 aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagt 46304136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 7432249 - 7432202
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| || |||||||||||||||||||||| |||||||    
7432249 taaaatatggttttaattcctgcaaatatgcctcgttttgattttagt 7432202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 19783814 - 19783865
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| |||||  |||||||||||||| |||||||||||||||||    
19783814 aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt 19783865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 20355407 - 20355458
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| ||||||||| |||||||||| |||||||||||| ||||    
20355407 aggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagt 20355458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 28528905 - 28529000
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| | |||| ||||||| ||||||| ||||||||| |||||        || ||||||| ||| ||||||||||||||||    
28528905 ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgtaattttttttgttgttttcggttcctgcaaaatattttg 28529000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||| |||||  |||||||||||||||||||||||| ||||||| ||||    
30352904 ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg 30352849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 30709645 - 30709594
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| ||||  |||||||||||||| |||||||||||||||||    
30709645 aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt 30709594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 365 - 416
Target Start/End: Complemental strand, 31732453 - 31732402
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||||||||||||||||||  ||| |||||||||||||||||||| ||||||    
31732453 aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag 31732402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Original strand, 34877777 - 34877824
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| |||||| ||||||| |||||||||||||||||    
34877777 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagt 34877824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 37527421 - 37527366
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||||| |||||||| || |||||||||||||| |||||    
37527421 gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgt 37527366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 421
Target Start/End: Original strand, 38486477 - 38486532
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 421  Q
    ||||||||||||| ||||| |||||| ||||||| |||||||| ||||||||||||    
38486477 aggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcct 38486532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 41365213 - 41365158
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  | || |||||||||||||||||||||||||||| ||||    
41365213 gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagtttctgt 41365158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 1007229 - 1007179
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||| |||||||||||||||||| |||||||    
1007229 ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagt 1007179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 5308688 - 5308631
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||| | ||||||||||||| |||||||||||||||||| |||||    
5308688 aaggctaaaatatgttttag-tccctgcaaatatacctcgttttggttttagtccctgt 5308631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 371 - 417
Target Start/End: Original strand, 6954862 - 6954908
Alignment:
371 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| |||||||||||||  |||||||||||||||||    
6954862 aaaatatggttttggtccctgcaaatatatctcgttttggttttagt 6954908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 17854151 - 17854205
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||||||||||| ||| ||||||||||||| |||||    
17854151 ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt 17854205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 21554393 - 21554443
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| ||||  |||||| |||||||||||||||||||||||||    
21554393 ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagt 21554443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 23817036 - 23816978
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  || ||| ||||||| ||||||||||| |||||||||||    
23817036 aaggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgt 23816978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 24717532 - 24717482
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| ||||| | |||||| |||||||||||||||||    
24717532 ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagt 24717482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 28263069 - 28263015
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||||||||||  | |||||| ||||||| |||||    
28263069 ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgt 28263015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 417
Target Start/End: Original strand, 30709321 - 30709375
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| ||||||||| ||||  ||||| ||||||||||||||||||||||||||    
30709321 ttaaggttaaaatatgattttagtccctacaaatatgcctcgttttggttttagt 30709375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 31503418 - 31503516
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||| |||||||||||||||  ||||| ||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
31503418 aaggttaaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatattttg 31503516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 415
Target Start/End: Original strand, 36684533 - 36684583
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||| |||||||| |||||||||  |||||||||||||||    
36684533 aaggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta 36684583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 39719353 - 39719403
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||| |||||||||||| |||||||||||||    
39719353 ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagt 39719403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 44403249 - 44403199
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||| |||||||||| |||||||||||||||||    
44403249 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 44403199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 6892261 - 6892204
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||| ||| || ||||||| |||||| |||||    
6892261 aggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgt 6892204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 19465981 - 19465925
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| | ||||||||||||| ||||||| ||||||||| |||||    
19465981 aggctaaaatatggtttt-agccctgcaaatatgtctcgtttcggttttagtccctgt 19465925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #160
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 43300613 - 43300662
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||  | |||||||||||| |||||||||||||||||    
43300613 gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagt 43300662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #161
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 423
Target Start/End: Original strand, 45671217 - 45671270
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  ||| |||||||||| |||||||| ||||||||||||||    
45671217 taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgt 45671270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 5308323 - 5308379
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||| |||||||||| |||||||| |||||||| |||||    
5308323 ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt 5308379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 370 - 414
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||||| || ||||||||||| ||||||||||||||    
28529206 taaaatatggttttggtctctgcaaatatgtctcgttttggtttt 28529162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 31310364 - 31310460
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||| ||||  |||||||||||||  |||||||||||||||||  ||||          ||||||||||||||||||||||| |||||    
31310364 aggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttg 31310460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 415
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||| ||||  ||||||||||||||| ||||||||||||||    
32189076 ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta 32189124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #166
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 37953057 - 37953001
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||| ||||||||||||||  |||||| ||||||| || ||||||||||||||    
37953057 ttttaaggataaaatatggttttagtccctgtaaatatgtcttgttttggttttagt 37953001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #167
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 46304384 - 46304328
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| |||||  ||||||||||||||  |||||||||||||||| |||||    
46304384 ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgt 46304328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 368 - 415
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||  || || ||||||||||||||||||||||||    
18311581 gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta 18311628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 367 - 418
Target Start/End: Original strand, 19005598 - 19005649
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    ||||||||||| |||||| |||||| ||||||| ||||||||| ||||||||    
19005598 ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagtt 19005649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #170
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 31503780 - 31503733
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||  |||||||||||||| ||||||||| |||||||    
31503780 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 31503733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #171
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 380 - 423
Target Start/End: Complemental strand, 41054163 - 41054120
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| |||||||||||||||||| ||||||||||||| |||||    
41054163 ttttggtccctgcaaatatgcctcattttggttttagtccctgt 41054120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 489074 - 489016
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||  || ||||||||||| ||||||||| ||||||| |||||    
489074 aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgt 489016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 432 - 462
Target Start/End: Original strand, 6911149 - 6911179
Alignment:
432 ttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||||||||||||||    
6911149 ttattgtttttggtccctgcaaaatattttg 6911179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 393 - 423
Target Start/End: Complemental strand, 22540265 - 22540235
Alignment:
393 aaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||||||||||    
22540265 aaatatgcctcgttttggttttagttcctgt 22540235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #175
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 419
Target Start/End: Complemental strand, 24954156 - 24954098
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||| ||||||||||| ||   |||||||||||||  ||||||||||||||||||    
24954156 ttttaaggttaaaatatggtcttagaccctgcaaatatgattcgttttggttttagttc 24954098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #176
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 365 - 399
Target Start/End: Original strand, 41693643 - 41693677
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatg 399  Q
    |||||||||||||| ||||||||||||||||||||    
41693643 aaggctaaaatatgtttttgatccctgcaaatatg 41693677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #177
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 408
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgtttt 408  Q
    ||||||||||||||| |||||||||||||| ||||||||    
44841711 taaaatatggttttggtccctgcaaatatgactcgtttt 44841673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #178
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 380 - 417
Target Start/End: Complemental strand, 3808106 - 3808069
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||| |||||||||||||| |||||||||||||||||    
3808106 ttttggtccctgcaaatatgtctcgttttggttttagt 3808069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #179
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 415
Target Start/End: Original strand, 12894060 - 12894089
Alignment:
386 tccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||||||||||    
12894060 tccctgcaaatatgcctcgttttggtttta 12894089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #180
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 423
Target Start/End: Complemental strand, 19758040 - 19758003
Alignment:
386 tccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||||||||||||| |||||    
19758040 tccctgcaaatatgcctcattttggttttagtccctgt 19758003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #181
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 18311938 - 18311890
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||| |||| ||||||  ||||||||||||||||| |||||||    
18311938 ctaaaatatgattttaatccctctaaatatgcctcgttttgattttagt 18311890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #182
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 21488335 - 21488383
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||||||| | | || |||| ||||||||    
21488335 ctaaaatatggttttgatccctgcaaatttacttcattttagttttagt 21488383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 55; Significance: 2e-22; HSPs: 146)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 12299142 - 12299084
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
12299142 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt 12299084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 19321132 - 19321036
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||        || |||||||||||| ||| |||||||||||    
19321132 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttactgtaattttttttgttgtttttggtcgctgtaaaatattttg 19321036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 20467719 - 20467663
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
20467719 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 20467663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 366 - 459
Target Start/End: Complemental strand, 3969010 - 3968916
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
3969010 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 3968916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 1007510 - 1007453
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
1007510 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 1007453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 3414386 - 3414443
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
3414386 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 3414443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 21993786 - 21993883
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
21993786 aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 21993883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 22543353 - 22543450
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
22543353 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 22543450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 365 - 454
Target Start/End: Original strand, 25136992 - 25137081
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaa 454  Q
    |||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||        || ||||||||||||||||||||    
25136992 aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaa 25137081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 25137358 - 25137301
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
25137358 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 25137301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 12419939 - 12419883
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
12419939 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 12419883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 17765007 - 17765106
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt--nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
17765007 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttg 17765106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 21994404 - 21994348
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
21994404 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 21994348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 32885672 - 32885728
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
32885672 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 32885728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 363 - 422
Target Start/End: Complemental strand, 6412583 - 6412524
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||    
6412583 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 6412524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 12419707 - 12419758
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||    
12419707 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 12419758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 363 - 422
Target Start/End: Complemental strand, 24274135 - 24274076
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
24274135 ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 24274076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 1007118 - 1007180
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||    
1007118 tttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt 1007180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 363 - 417
Target Start/End: Original strand, 13268105 - 13268159
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||| |||||||||||||||||||||| |||||||||    
13268105 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagt 13268159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 19690391 - 19690449
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
19690391 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 19690449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 21385586 - 21385488
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||          || ||||||||||||||||||||||||||||    
21385586 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 21385488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 364 - 417
Target Start/End: Complemental strand, 3276357 - 3276304
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
3276357 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3276304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 3968643 - 3968700
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
3968643 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3968700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 6412217 - 6412314
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
6412217 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 6412314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 10910965 - 10910908
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
10910965 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 10910908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 364 - 417
Target Start/End: Original strand, 12757607 - 12757660
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
12757607 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12757660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 15076206 - 15076149
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
15076206 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 15076149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 21147403 - 21147460
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||    
21147403 aggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgt 21147460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 21385249 - 21385306
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
21385249 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 21385306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 414
Target Start/End: Original strand, 23502235 - 23502284
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||    
23502235 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 23502284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 24273826 - 24273883
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||||||||    
24273826 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg 24273883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 33801745 - 33801688
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
33801745 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 33801688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 34582524 - 34582585
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
34582524 tttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 34582585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 418
Target Start/End: Complemental strand, 778043 - 777991
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    |||||||||||||||||| |||||||||||||||||||||||| |||||||||    
778043 aggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtt 777991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 7156161 - 7156105
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
7156161 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 7156105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 15962389 - 15962333
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
15962389 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 15962333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 22543719 - 22543663
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
22543719 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 22543663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 1214997 - 1214946
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||||||||    
1214997 aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagt 1214946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 8170152 - 8170101
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
8170152 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8170101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 14656263 - 14656204
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |||||    
14656263 taaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt 14656204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
31198615 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 31198670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 494405 - 494455
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||    
494405 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 494455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 13617531 - 13617585
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
13617531 ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgt 13617585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 21995062 - 21995120
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||| ||||||||||||||||||||||| |||||    
21995062 aaggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgt 21995120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 415
Target Start/End: Complemental strand, 23502546 - 23502492
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||||||  |||||||||||||| |||||||||||||||    
23502546 ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 23502492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 24901239 - 24901289
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||||    
24901239 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 24901289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 415
Target Start/End: Original strand, 26375691 - 26375741
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||    
26375691 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta 26375741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 30928679 - 30928737
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
30928679 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 30928737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 368 - 422
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
31166871 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 31166925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 34990321 - 34990259
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||| ||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
34990321 ttttaaggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 34990259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 318098 - 318041
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||||  |||||||||||||||| |||||    
318098 aggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgt 318041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 3414754 - 3414697
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||| ||||||| ||||||||||||||||| ||||    
3414754 aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg 3414697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 369 - 462
Target Start/End: Complemental strand, 5286949 - 5286856
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||  |||||||||||||||||| ||||||||||||| ||||           |||||||||||||||||||||||||||||    
5286949 ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaatattttg 5286856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 6468308 - 6468405
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||  ||||||||||||||| | |||||||||||||| |||||          ||||||||||||||||||||||| |||||    
6468308 aaggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttg 6468405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 7155795 - 7155852
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||| |||||  |||||||||||||||||||||||||||||||| ||||    
7155795 aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 7155852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 8681118 - 8681061
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  ||||||||||||||||| |||||||||||||| ||||    
8681118 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 8681061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 18024376 - 18024319
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||    
18024376 aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgt 18024319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 19267560 - 19267621
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| |||||||||||||||||| |||||| |||||||| |||||||||||||||| |||||    
19267560 tttatggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt 19267621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 20467349 - 20467406
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| |||||||| |||||| |||||||||||||||||||||||||||||||| ||||    
20467349 aaggataaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg 20467406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 22822653 - 22822596
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
22822653 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 22822596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 25431855 - 25431798
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
25431855 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 25431798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 26376042 - 26375989
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
26376042 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 26375989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 34582893 - 34582836
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||||||||||||| |||||||||||||||||| |||||    
34582893 aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgt 34582836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 1890453 - 1890397
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
1890453 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 1890397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 3356140 - 3356192
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
3356140 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt 3356192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 8680774 - 8680830
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||||||||| ||||    
8680774 aggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg 8680830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 14655378 - 14655434
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  ||||||||||||||| |||||||||||||||| ||||    
14655378 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 14655434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 15962026 - 15962082
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  ||| |||||||||||||||||||||||||||| ||||    
15962026 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 15962082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 19129335 - 19129391
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||| ||||||| |||| |||||||||||||||||||||||||||||||| ||||    
19129335 aggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg 19129391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 19296407 - 19296359
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
19296407 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 19296359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 22792901 - 22792849
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| |  ||||||||||||||||||||||||||||||||    
22792901 aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagt 22792849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 30929044 - 30928988
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
30929044 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 30928988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 371 - 422
Target Start/End: Original strand, 543365 - 543416
Alignment:
371 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||  |||||||||||||||||||||||||||||||| ||||    
543365 aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 543416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 2615871 - 2615922
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||| ||||||||||||||||||    
2615871 aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt 2615922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 3356495 - 3356448
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||    
3356495 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 3356448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 363 - 462
Target Start/End: Original strand, 11448533 - 11448632
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||| ||||  |||||||||||||| ||||||||||||||||| || ||          ||||||||||||||||||||||| |||||    
11448533 ttaaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaaaaaaaaaaattgtttttggtccctgcaaaattttttg 11448632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 14428651 - 14428706
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
14428651 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 14428706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 23770162 - 23770217
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
23770162 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 23770217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 30479421 - 30479366
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| | | |||||||||||||||||||||||||||| |||||    
30479421 gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgt 30479366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 2373177 - 2373235
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||||| ||||||||| |||| |||||    
2373177 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgt 2373235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 11449171 - 11449113
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||| ||||||||||||||||||||||| |||| |||||    
11449171 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgt 11449113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 12612365 - 12612303
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||| ||  ||||||||||||||||||||||| |||||||| |||||    
12612365 tttttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgt 12612303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 13150752 - 13150694
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| || | ||||||||||||| ||||||||||||||||| |||||    
13150752 aaggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgt 13150694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| ||||||||||||| |||||||||| |||||||    
15442937 ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt 15442987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 17771911 - 17771961
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||||||||||||| ||||||||||||||||    
17771911 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 17771961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 33131852 - 33131794
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||  |||||||||||||||||||||||||||| |||||    
33131852 aaggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgt 33131794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 414
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||||  ||||||||||||||||| |||||||||||    
2616242 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt 2616193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 414
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||||  |||| ||||||||||||||||||||||||    
6591113 aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt 6591162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 7324189 - 7324136
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
7324189 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 7324136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 12176640 - 12176587
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
12176640 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 12176587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 370 - 423
Target Start/End: Original strand, 18024014 - 18024067
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| ||  |||||||||||||||||||||||||||| |||||    
18024014 taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgt 18024067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 19129521 - 19129464
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||| |||||||||||||| | ||||||||||||||| |||||    
19129521 aggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgt 19129464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 25121497 - 25121440
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| | ||||||||||||  |||||||||||||||| |||||    
25121497 aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgt 25121440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 9896639 - 9896587
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| || ||||||||||||||    
9896639 aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt 9896587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 10910629 - 10910685
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| || || |||||||| ||||||||||||||||| |||||    
10910629 ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgt 10910685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 419
Target Start/End: Complemental strand, 11129543 - 11129491
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||| ||||  ||||||||||||||||||||||||||||| ||||    
11129543 ggctaaaatatgattttactccctgcaaatatgcctcgttttggttttcgttc 11129491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 379 - 423
Target Start/End: Complemental strand, 13617804 - 13617760
Alignment:
379 gttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||| |||||||||||||||||||||||||||||||| |||||    
13617804 gttttggtccctgcaaatatgcctcgttttggttttagtccctgt 13617760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 21995425 - 21995369
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||| ||||||||||||||||||||| |||||| |||||    
21995425 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgt 21995369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 22822305 - 22822357
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  || |||||||||| ||||||||||||||||||    
22822305 aaggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt 22822357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 24692980 - 24692924
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
24692980 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg 24692924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 31186591 - 31186535
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  | ||||||||||||||||||||| |||||||| |||||    
31186591 ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgt 31186535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||| ||||||||||||||||| ||||||| ||||    
33808619 aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg 33808675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 361 - 416
Target Start/End: Original strand, 317806 - 317861
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||| |||||||||||| |||||  |||||||||||||| ||||||||||||||||    
317806 tttttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag 317861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 415
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||  |||||||||||||| |||||||||||||||    
494751 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 494704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 6564944 - 6564894
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||| |||||||| |||||||||||||| |||||||||||||||||    
6564944 aggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagt 6564894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Original strand, 12298825 - 12298872
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| |||||||||||||| |||||||| ||||||||    
12298825 taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagt 12298872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 15722901 - 15722850
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| |||||||| ||||||||||||||| || |||||||||||    
15722901 aggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagt 15722850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 25121183 - 25121233
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||| |||||||||| |||||||||||||||||    
25121183 aggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagt 25121233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 25431573 - 25431632
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| |||| ||||||| |||||||  |||||||| |||||||||||||    
25431573 taaggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgt 25431632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
31167200 ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg 31167145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 9896280 - 9896334
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| ||||||||||||||| ||| |||| |||||||| |||||    
9896280 ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgt 9896334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 14655897 - 14655959
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| |||||||| ||||||||| |||||||||||||   |||||||||||||||| |||||    
14655897 ttttagggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgt 14655959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 17765377 - 17765319
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||| |||||||||||||| ||||||||  ||||||| |||||    
17765377 aaggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgt 17765319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 19296106 - 19296164
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| ||||||||  ||||||||||||||| |||||||| ||||||| |||||    
19296106 aaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgt 19296164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 415
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||| |||||||||||||| ||| |||||||||||    
19320769 ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta 19320815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 366 - 408
Target Start/End: Complemental strand, 23770440 - 23770398
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgtttt 408  Q
    ||||||||||||||||||  |||||||||||||||||||||||    
23770440 aggctaaaatatggttttagtccctgcaaatatgcctcgtttt 23770398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #117
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 777675 - 777732
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||| ||||  | ||||||||||| |||||||||||||||||| ||||    
777675 aaggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg 777732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #118
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 364 - 417
Target Start/End: Original strand, 1214693 - 1214746
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| |||||| |||||||||||||| | | |||||||||||||    
1214693 taaggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagt 1214746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #119
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 1875501 - 1875558
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| | ||| |||||||||||||||||||||||||| ||| || |||||    
1875501 aggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgt 1875558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #120
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 1890057 - 1890114
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||  |||||| ||||||||||||||||| ||||||| ||||    
1890057 aaggttaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg 1890114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #121
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 369 - 418
Target Start/End: Complemental strand, 6591440 - 6591391
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    |||||||||||||||  | |||||||||||| ||||||||||||||||||    
6591440 ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtt 6591391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #122
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 423
Target Start/End: Original strand, 10091039 - 10091092
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  ||||||||||||||  |||||||||||||||| |||||    
10091039 taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 10091092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #123
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 419
Target Start/End: Complemental strand, 11926034 - 11925981
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    ||||||||||||||||||| || ||| ||||||| | |||||||||||||||||    
11926034 aggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagttc 11925981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #124
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 364 - 417
Target Start/End: Complemental strand, 14428953 - 14428900
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| |||||||||||||||  ||| ||||||||||| ||||||||||||||||    
14428953 taagactaaaatatggttttagtccttgcaaatatgcttcgttttggttttagt 14428900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #125
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 15722609 - 15722666
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| ||  |||||||||| ||||||||| ||||||| |||||    
15722609 aggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgt 15722666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #126
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 23628799 - 23628848
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| |||||||||||||   ||||||||||||||||    
23628799 gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagt 23628848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #127
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 34989962 - 34990011
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| ||||  |||||||||||||||||||||||| |||||||    
34989962 gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagt 34990011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #128
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 6564580 - 6564632
Alignment:
366 aggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||| ||||||||| | |||||||||||||| |||||||||||||||||    
6564580 aggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagt 6564632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #129
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 361 - 420
Target Start/End: Original strand, 15116667 - 15116724
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc 420  Q
    |||| ||||||||||||||||||  || ||||||||||  ||||||||||||||||||||    
15116667 tttttaggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagttcc 15116724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #130
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 30239287 - 30239343
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||| |||||||||||| ||||  | |||||||||||| |||||||||||||||||    
30239287 ttttatggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagt 30239343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #131
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 31398543 - 31398491
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||  |||||||||||||| ||| |||||||||||||    
31398543 aaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt 31398491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #132
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 364 - 403
Target Start/End: Complemental strand, 15117043 - 15117004
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctc 403  Q
    ||||||||||||||||||||  ||||||||||||||||||    
15117043 taaggctaaaatatggttttagtccctgcaaatatgcctc 15117004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #133
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 31276339 - 31276284
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||  |||||| |||||||||||||| ||||||||| ||||||| |||||    
31276339 gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgt 31276284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 11925739 - 11925789
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| ||||| ||||| |||||||||||||| ||||||||| |||||||    
11925739 ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagt 11925789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 19267914 - 19267856
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| | |||| ||||||| | | ||||||||||||| |||||    
19267914 aaggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgt 19267856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 371 - 409
Target Start/End: Complemental strand, 19690755 - 19690717
Alignment:
371 aaaatatggttttgatccctgcaaatatgcctcgttttg 409  Q
    |||||||||||||| |||||||||||||| |||||||||    
19690755 aaaatatggttttggtccctgcaaatatgtctcgttttg 19690717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 452
Target Start/End: Complemental strand, 24901555 - 24901469
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgca 452  Q
    ||||||||||||| ||||| ||||| |||||||| ||  ||||||||||||| |||||        || ||||||||||||||||||    
24901555 aggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgtaaaaaaaattgttgtttttggtccctgca 24901469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 412
Target Start/End: Original strand, 30479062 - 30479108
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt 412  Q
    ||||||||||||||||||| |||||| ||||||| | ||||||||||    
30479062 aggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt 30479108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 415
Target Start/End: Complemental strand, 543725 - 543676
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||| ||||  ||||||||||||||| | ||||||||||||    
543725 aggctaaaatatgattttagtccctgcaaatatgctttgttttggtttta 543676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 7323862 - 7323924
Alignment:
365 aaggctaaaatatggttttgat----ccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| ||    || |||||||||| ||||||||||||||||| |||||    
7323862 aaggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggttttagtccctgt 7323924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #141
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 367 - 420
Target Start/End: Original strand, 12611995 - 12612048
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc 420  Q
    |||||||||||||| ||  ||||||||||||||||  ||||| |||||||||||    
12611995 ggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcc 12612048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #142
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 380 - 417
Target Start/End: Complemental strand, 19275223 - 19275186
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||| |||||||||||||| |||||||||||||||||    
19275223 ttttggtccctgcaaatatgtctcgttttggttttagt 19275186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #143
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 370 - 414
Target Start/End: Original strand, 31276105 - 31276149
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||| |||||||||| ||||| |||||||||||| ||||||||||    
31276105 taaactatggttttggtccctacaaatatgcctcattttggtttt 31276149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #144
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 434 - 462
Target Start/End: Complemental strand, 33746961 - 33746933
Alignment:
434 attgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||||||||||||    
33746961 attgtttttggtccctgcaaaatattttg 33746933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #145
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Original strand, 34995113 - 34995145
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||| |||||||||||||||||||    
34995113 aggctaaaatatgcttttgatccctgcaaatat 34995145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #146
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Complemental strand, 34998201 - 34998169
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||| |||||||||||||||||||    
34998201 aggctaaaatatgcttttgatccctgcaaatat 34998169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 55; Significance: 2e-22; HSPs: 214)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 13530715 - 13530617
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
13530715 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 13530617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 24774043 - 24774141
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         |||||||||||||||| ||||||||||||||    
24774043 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttattgtttttggtccttgcaaaatattttg 24774141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 25423918 - 25424020
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
25423918 ttttaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 25424017  T
460 ttg 462  Q
    |||    
25424018 ttg 25424020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 43231391 - 43231293
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
43231391 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 43231293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 32365093 - 32365189
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||| |||||    
32365093 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttg 32365189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 360 - 462
Target Start/End: Complemental strand, 23779232 - 23779129
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatat 458  Q
    |||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||||||    
23779232 gttttaaggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgtcaattttttttgttgtttttggtccctgcaaaatat 23779133  T
459 tttg 462  Q
    ||||    
23779132 tttg 23779129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 53308068 - 53307973
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||| | ||||||||||||||| |||||        || ||||||||||||||||||||||||||||    
53308068 ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattttg 53307973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 2322434 - 2322376
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||    
2322434 aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgt 2322376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 29499180 - 29499278
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
29499180 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 29499278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 30046794 - 30046696
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
30046794 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 30046696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 30061135 - 30061037
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
30061135 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 30061037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 35464012 - 35464114
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
35464012 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 35464111  T
460 ttg 462  Q
    |||    
35464112 ttg 35464114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 45505896 - 45505838
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
45505896 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 45505838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 13631227 - 13631324
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
13631227 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 13631324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 14487801 - 14487898
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||         || ||||||||||||||||||||||||||||    
14487801 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 14487898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 23245596 - 23245539
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||    
23245596 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgt 23245539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 31560329 - 31560386
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
31560329 aaggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg 31560386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 31811920 - 31811981
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||||||||||||||||||  |||||||||||||||| |||||    
31811920 tttaaggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgt 31811981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 44925483 - 44925580
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||  | ||        || |||||||||||||| |||||||||||||    
44925483 aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtctcagtaaaaaaaattgttgtttttggtccccgcaaaatattttg 44925580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 53916048 - 53915951
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||          || ||||||||||||||||||||||||||||    
53916048 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 53915951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 18205150 - 18205206
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
18205150 ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 18205206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 26412189 - 26412245
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||    
26412189 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 26412245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 29420538 - 29420442
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||| |        |||||||||||  ||||||||||||||||||    
29420538 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctataattttttttattgttttttatccctgcaaaatattttg 29420442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 41324890 - 41324834
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||    
41324890 ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgt 41324834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 46115414 - 46115470
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
46115414 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 46115470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 46128548 - 46128604
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
46128548 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 46128604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
23245231 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23245286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
35464382 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35464327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
42848391 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 42848336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 52017502 - 52017561
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
52017502 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 52017561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 52017873 - 52017814
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
52017873 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 52017814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 54903478 - 54903419
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||    
54903478 taaggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt 54903419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 2180214 - 2180276
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||  |||||||||||||||||| ||||||||||||| |||||    
2180214 ttttaaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt 2180276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 5827975 - 5827917
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
5827975 aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgt 5827917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 13064467 - 13064409
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
13064467 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 13064409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 13631602 - 13631544
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
13631602 taaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg 13631544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 16712693 - 16712635
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
16712693 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 16712635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 419
Target Start/End: Original strand, 23778962 - 23779016
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
23778962 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc 23779016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 25424314 - 25424256
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
25424314 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 25424256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 26314334 - 26314276
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||    
26314334 aaggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgt 26314276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 29499549 - 29499491
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
29499549 taaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29499491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 363 - 417
Target Start/End: Original strand, 32208538 - 32208592
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
32208538 ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 32208592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 32208905 - 32208851
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||| |||||||    
32208905 ttaaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagt 32208851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 422
Target Start/End: Complemental strand, 6827880 - 6827819
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||  |||||||||||||||||||||||||||||||| ||||    
6827880 ttttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 6827819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 14791808 - 14791751
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
14791808 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 14791751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 29463915 - 29463818
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||| || |||||          ||||||||||||||||||||||| |||||    
29463915 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttg 29463818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 36701994 - 36702095
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattt 460  Q
    |||||||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||        || |||||||| ||||||||||||| |||    
36701994 ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaatttttgtttttgtttttagtccctgcaaaattttt 36702093  T
461 tg 462  Q
    ||    
36702094 tg 36702095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 41345851 - 41345908
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
41345851 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 41345908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 43231086 - 43231143
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
43231086 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 43231143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 45505595 - 45505656
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||  ||||||||||||||||| |||||||||||||| |||||    
45505595 tttaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 45505656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 414
Target Start/End: Original strand, 4211560 - 4211608
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||    
4211560 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 4211608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 13073759 - 13073815
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
13073759 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 13073815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 364 - 464
Target Start/End: Complemental strand, 20144734 - 20144634
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttga 463  Q
    ||||||||||||||||||||| | | ||||||||||||||||||||||||||   |||||        || |||||||||||||||||||||| ||||||    
20144734 taaggctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaacccctgtaaaaaaaattgttgtttttggtccctgcaaaatcttttga 20144635  T
464 t 464  Q
    |    
20144634 t 20144634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 31560695 - 31560599
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
31560695 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 31560599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 35415633 - 35415537
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct-gtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||| ||        || |||||||||||||||||||||| |||||    
35415633 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttg 35415537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 35763646 - 35763702
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
35763646 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 35763702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 362 - 414
Target Start/End: Original strand, 46292387 - 46292439
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||| |||||||||||||||||| |||||||||||||||||||||||||||||    
46292387 tttatggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 46292439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 47023106 - 47023050
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||||||||||||||  |||||||||||||||| ||||    
47023106 aggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg 47023050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 363 - 462
Target Start/End: Original strand, 50753918 - 50754018
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    |||||| ||||||||||||||| |||||||||||||  || ||||||||||||||||||||         || |||||||||||||||||||||||||||    
50753918 ttaaggttaaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaaatttcttttgttgtttttggtccctgcaaaatatttt 50754017  T
462 g 462  Q
    |    
50754018 g 50754018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 53717174 - 53717118
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
53717174 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 53717118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 53915682 - 53915738
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||    
53915682 aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 53915738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 2322094 - 2322149
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||    
2322094 gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgt 2322149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 6353637 - 6353582
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||    
6353637 gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt 6353582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 13074126 - 13074075
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| ||||||||||||| ||||||||||||||||||    
13074126 aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagt 13074075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 20291985 - 20292036
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
20291985 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt 20292036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 362 - 417
Target Start/End: Original strand, 22099538 - 22099593
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| |||||||||||||||||  ||||||||||||||||||||||||||||||||    
22099538 tttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 22099593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
26412584 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 26412529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 51763201 - 51763146
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| |||||| |||||||||||||||||| |||||||||||||||||||    
51763201 gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgt 51763146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 2034857 - 2034799
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||| ||||||||||||||||||||||||||| |||||    
2034857 aaggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgt 2034799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 415
Target Start/End: Original strand, 8904884 - 8904934
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||| |||||| ||||||||||||||||||||||||||||||    
8904884 aaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta 8904934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 13064153 - 13064215
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||| ||||||| |||||    
13064153 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 13064215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 18205521 - 18205467
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
18205521 ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 18205467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 462
Target Start/End: Complemental strand, 19903653 - 19903559
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||| |||||||||||||| ||||||||||||||||| | |||         || ||||||||||||||||||||||||||||    
19903653 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaatattttg 19903559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 22099916 - 22099862
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||  |||||||||||||| |||||||||||||||||    
22099916 ttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 22099862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 31812215 - 31812157
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||| |||||    
31812215 aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt 31812157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 32365485 - 32365427
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
32365485 aaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt 32365427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 35119290 - 35119348
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||||  ||||||||||||||| |||||    
35119290 aaggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgt 35119348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 36054152 - 36054094
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||||| |||||||||||||||||| ||||||||||||| |||||    
36054152 aaggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgt 36054094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 38054544 - 38054602
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
38054544 aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 38054602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 42848025 - 42848083
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||| |||||    
42848025 aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt 42848083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 45593592 - 45593530
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  || ||||||||||| |||||||||||||||||||||||    
45593592 tttttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgt 45593530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 55072387 - 55072445
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
55072387 aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 55072445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 364 - 417
Target Start/End: Original strand, 6827543 - 6827596
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||  ||| ||||||||||||||||||||||||||||    
6827543 taaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 6827596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 11693122 - 11693065
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||||    
11693122 aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgt 11693065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 12152494 - 12152437
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||| || |||||    
12152494 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgt 12152437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 12791975 - 12791918
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
12791975 aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgt 12791918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 13479612 - 13479555
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
13479612 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 13479555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 14488188 - 14488131
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||    
14488188 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt 14488131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 42823775 - 42823832
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||    
42823775 aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgt 42823832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 364 - 417
Target Start/End: Original strand, 51545626 - 51545679
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||  ||||||||||||| ||||||||||||||||||    
51545626 taaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt 51545679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 51545966 - 51545913
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
51545966 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 51545913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 362 - 415
Target Start/End: Original strand, 52543417 - 52543470
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||| ||| |||||||||| |||||||||||||||    
52543417 tttaaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 52543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 123533 - 123589
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||| ||||||||||||| ||||    
123533 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 123589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 5052586 - 5052534
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||| |||||||||||  ||||||||||||||||||||||||||||||||    
5052586 aaggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagt 5052534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 5827655 - 5827711
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||    
5827655 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt 5827711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 363 - 423
Target Start/End: Original strand, 8760600 - 8760660
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| |||||  |||||||||||||| ||||||||||||||||| |||||    
8760600 ttaaggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgt 8760660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 198 - 255
Target Start/End: Original strand, 9075166 - 9075225
Alignment:
198 tataaagtaagaattttaaca--gtcttgaaccagttcagattatataatccaaacattt 255  Q
    ||||||||| |||||||||||  ||||||||| |||||||||||||||||||||||||||    
9075166 tataaagtatgaattttaacacagtcttgaacgagttcagattatataatccaaacattt 9075225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 9289265 - 9289321
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
9289265 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 9289321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 9289640 - 9289544
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||| ||||||||||||  |||||||||||||| ||||||||||||||||| ||||           |||||||||||||||||||||||||||||    
9289640 aggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaatattttg 9289544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 13530378 - 13530434
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||    
13530378 aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 13530434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 13764613 - 13764669
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||| ||| |||||    
13764613 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgt 13764669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
15555506 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 15555558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 16712331 - 16712379
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| ||||||||||||||||||||||||||| |||||    
16712331 ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagt 16712379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 19321859 - 19321803
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||||||||||||||  |||||||||||||||| |||||    
19321859 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt 19321803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 24474965 - 24474913
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||    
24474965 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 24474913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 26313988 - 26314044
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||||||||||||||   ||||||||||||||| |||||    
26313988 ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgt 26314044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 27008084 - 27008140
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| |||||  |||||||||||||||||||||||||||||||| |||||    
27008084 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt 27008140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 359 - 415
Target Start/End: Complemental strand, 28449222 - 28449166
Alignment:
359 agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||||||||| ||| |||||||||| ||||||||| |||||    
28449222 agttttaaggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta 28449166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 28809182 - 28809130
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
28809182 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt 28809130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 29380912 - 29380860
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||    
29380912 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 29380860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||||||||||||||||||||| ||||||| ||||    
30060772 taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg 30060824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 34361801 - 34361853
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||    
34361801 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 34361853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
41619902 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 41619954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 46088061 - 46088005
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
46088061 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 46088005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 46292653 - 46292601
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||||||| |||||||||||||    
46292653 aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt 46292601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 51709029 - 51708977
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||||||| |||||||||||||    
51709029 aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt 51708977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 54208827 - 54208775
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||| |||||||||||||| |||||||||||||||||    
54208827 aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 54208775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 372 - 423
Target Start/End: Original strand, 2034544 - 2034595
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||| ||||| |||||||||||||||||||||||||||||||| |||||    
2034544 aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt 2034595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 9445946 - 9446005
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| |||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
9445946 taagactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 9446005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 11285504 - 11285559
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
11285504 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 11285559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 370 - 417
Target Start/End: Original strand, 14791502 - 14791549
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| |||||||||||||||||| |||||||||||||    
14791502 taaaatatggttttggtccctgcaaatatgcctcattttggttttagt 14791549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 29463610 - 29463665
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  | |||||||||||||||||||||||||||| ||||||    
29463610 ggctaaaatatggttttatttcctgcaaatatgcctcgttttggttttaattcctg 29463665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 36050289 - 36050344
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||||    
36050289 gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgt 36050344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 37557194 - 37557139
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||||||||||||| |||||||||| ||||||| |||||    
37557194 gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgt 37557139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 44925844 - 44925789
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| || | ||||||||||||||||||||||||||| |||||    
44925844 gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgt 44925789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 364 - 462
Target Start/End: Original strand, 47022737 - 47022836
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||| ||||||||||||||| ||| |||||||||| ||||||||||||||||| ||| |         || ||||||||||||||||||||||||||||    
47022737 taaggataaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattttg 47022836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 372 - 423
Target Start/End: Complemental strand, 47532667 - 47532616
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||| |||||||||| |||||||||||||||||||||||    
47532667 aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgt 47532616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||||||| ||||||||||||| ||||    
50714240 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 50714295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
50714565 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 50714510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 51708692 - 51708743
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
51708692 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt 51708743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 8760783 - 8760725
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||| |||||||||| ||||||||||||||||| |||||    
8760783 aaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgt 8760725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 18136115 - 18136057
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  ||| |||||| |||||||||||||||||||||||||| |||||    
18136115 aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt 18136057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 370 - 416
Target Start/End: Original strand, 20144423 - 20144469
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    ||||||||||||||| ||||||||||||||||||||||| |||||||    
20144423 taaaatatggttttggtccctgcaaatatgcctcgttttagttttag 20144469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 27427869 - 27427926
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| | |||||||||||||| ||||||||||||||||| ||||    
27427869 taaggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctg 27427926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 31182506 - 31182448
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| || |||||||||||| ||||||||||||| ||| |||||    
31182506 aaggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgt 31182448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 41620259 - 41620201
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||| |||||||| |||||||||||||||| ||||    
41620259 taaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg 41620201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 45474600 - 45474546
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||  ||||||||||||||| ||| ||||||||||||    
45474600 ttaaggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt 45474546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 49123323 - 49123265
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  ||| |||||| |||||||||||||||||||||||||| |||||    
49123323 aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt 49123265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 51762868 - 51762966
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||| ||| || |||||||||||| || ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
51762868 aaggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 51762966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 52442094 - 52442036
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||| |||||||||| ||||||||||||||||| |||||    
52442094 aaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt 52442036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 54903109 - 54903167
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||||| ||||||||| ||||||| |||||| |||||||    
54903109 aaggttaaaatatggttttgatccctacaaatatgcatcgttttagttttaattcctgt 54903167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 5882551 - 5882607
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
5882551 aggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgt 5882607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 12152153 - 12152210
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| |||||||  |||||||| |||||    
12152153 aggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgt 12152210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 364 - 417
Target Start/End: Complemental strand, 13764810 - 13764757
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||| |||||| |||||||  ||||||||||||||||    
13764810 taaggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagt 13764757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 360 - 417
Target Start/End: Original strand, 14594199 - 14594256
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||| ||||||||||||||||||| |||||||||||||| |||  ||||||||||||    
14594199 gtttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagt 14594256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 19903260 - 19903317
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||| ||||||| |||||    
19903260 aggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgt 19903317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 35763956 - 35763859
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct-gtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||| ||||  |||||||| ||||||||||||||||||||||| ||| ||        || |||||||||||||||||||||| |||||    
35763956 aggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttg 35763859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 46115781 - 46115724
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||| | ||||||||||||||||| ||||    
46115781 aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg 46115724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 46128915 - 46128858
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||| | ||||||||||||||||| ||||    
46128915 aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg 46128858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 47136170 - 47136121
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| |||||||||||||| ||| |||||||||||||    
47136170 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 47136121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 51738136 - 51738185
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||| ||||| |||||||| |||||||||||||||    
51738136 aggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta 51738185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 52430101 - 52430044
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| |||||||| |||||||| |||||    
52430101 aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt 52430044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 52441762 - 52441819
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
52441762 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 52441819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 370 - 415
Target Start/End: Complemental strand, 55072709 - 55072664
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||    
55072709 taaaatatggttttagtccctgcaaatatgcctcgttttggtttta 55072664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 370 - 417
Target Start/End: Original strand, 5202929 - 5202977
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcg-ttttggttttagt 417  Q
    ||||||||||||||| ||||||||||||||||||| |||||||||||||    
5202929 taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagt 5202977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 8191391 - 8191335
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||| ||||| ||| |||||    
8191391 ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt 8191335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 5 - 89
Target Start/End: Original strand, 9075001 - 9075085
Alignment:
5 agtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttata 89  Q
    |||||||||||||||||||||  | | |||| |||| ||||||||||||||||| ||||||||| || | |||  ||||||||||    
9075001 agtttggtgttcagatcaatgatcaaagtgtacatggttatttggtgtggtttacaacatatgaaaaaacacacactaatttata 9075085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 454
Target Start/End: Original strand, 11692761 - 11692849
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaa 454  Q
    |||||||||| |||||||| |||||||||||||||| ||||||| ||||||| ||| |        || ||||||||||||||||||||    
11692761 aggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccctataattttttttgttgtttttggtccctgcaaa 11692849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 19321569 - 19321625
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||| ||||| |||||| ||| ||||||||||||||||||||| ||||    
19321569 aggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg 19321625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 35415298 - 35415354
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||| |||||||| |||||||||||||||| ||||    
35415298 aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg 35415354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 369 - 462
Target Start/End: Complemental strand, 35420701 - 35420606
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt--nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||| ||| |||||||||| |||| |||||||||||| |||||          || ||||||||||||||||||||||||||||    
35420701 ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaattttttttttgttgtttttggtccctgcaaaatattttg 35420606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 43368777 - 43368721
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| || || |||||||||  ||||||||||||||||||||||    
43368777 ggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgt 43368721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #163
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 414
Target Start/End: Complemental strand, 51738412 - 51738364
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||||||||| ||| |||||||||||||||||||| ||||    
51738412 aggctaaaatatggttttggtccatgcaaatatgcctcgttttgatttt 51738364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #164
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 55482468 - 55482412
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||  ||||| |||||||||||||||||||||||||| |||||    
55482468 ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgt 55482412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #165
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 415
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||  |||||||||||||| |||||||||||||||    
13479273 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 13479320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #166
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 22584286 - 22584337
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||| |||||||||| |||||||||||||||||    
22584286 aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 22584337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #167
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||| ||||| |||||| ||||||| ||||||||||||||||| ||||    
25358540 ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg 25358485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #168
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 372 - 423
Target Start/End: Complemental strand, 27008401 - 27008350
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||  || ||||||||||||||||||||||||||||| |||||    
27008401 aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt 27008350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #169
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 28448833 - 28448884
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||| | ||||||||||||||||||||||||||    
28448833 aggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagt 28448884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #170
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 413
Target Start/End: Complemental strand, 35119612 - 35119565
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    ||||||||||||||||||| || ||||||||||| |||||||||||||    
35119612 aggctaaaatatggttttggtcactgcaaatatgtctcgttttggttt 35119565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #171
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 36702362 - 36702307
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  | |||||| ||||||||||||||||||||||| |||||    
36702362 gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgt 36702307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #172
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 41346219 - 41346168
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| ||| |||||||||||||    
41346219 aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagt 41346168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #173
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 362 - 417
Target Start/End: Complemental strand, 41921089 - 41921034
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||||   |||||||||||||  ||||||||||||||||    
41921089 tttaaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagt 41921034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #174
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 53716920 - 53716971
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| || ||||||||||||||    
53716920 aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt 53716971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #175
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 4279335 - 4279285
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| ||||  |||||||||||||| |||||||||||||||||    
4279335 ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagt 4279285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #176
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 35420393 - 35420447
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| |||| |||||||||| | |||||||||||||| |||||    
35420393 ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgt 35420447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #177
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 36 - 118
Target Start/End: Original strand, 41967707 - 41967789
Alignment:
36 ccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtgtgtcgtggatcacaaaa 118  Q
    ||||||||||||||||||||||| ||||||||| ||||  ||  |||||||||||||| || | || |||||| | |||||||    
41967707 ccatgattatttggtgtggtttacaacatatgaaaacaagcacactaatttatagaagtttctttgcgtcgtgtaccacaaaa 41967789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #178
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 42824091 - 42824041
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||||||||||||| || |||||| |||||||    
42824091 ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagt 42824041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #179
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 43368467 - 43368521
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  ||||||||||||||  |||||||||||||||| |||||    
43368467 ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 43368521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #180
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 123893 - 123848
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||  |||||||||||||||||| |||||||||||||    
123893 aaatatggttttagtccctgcaaatatgcctcattttggttttagt 123848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #181
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 4279021 - 4279078
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||   ||||||||||||  ||||||||||||||||| |||||    
4279021 aggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgt 4279078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #182
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 423
Target Start/End: Original strand, 5797484 - 5797537
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| ||||| || ||||||||||| ||||||||||||||||| |||||    
5797484 taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgt 5797537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #183
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 415
Target Start/End: Complemental strand, 5797817 - 5797772
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||| ||||| |||||||| |||||||||||||||    
5797817 taaaatatggttttggtccctacaaatatgtctcgttttggtttta 5797772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #184
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 15555637 - 15555588
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||| |||||  |||||||||||||| |||||||||||||||||    
15555637 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt 15555588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #185
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 22584608 - 22584551
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| |||||||  || |||||||||||| |||||||||||||||| |||||    
22584608 aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgt 22584551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #186
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 365 - 414
Target Start/End: Original strand, 29380666 - 29380715
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||| |||||  |||||||||||||| ||||||||||||||    
29380666 aaggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt 29380715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #187
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 34355284 - 34355227
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||  ||||||| ||||||||||||||||| |||||    
34355284 aggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgt 34355227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #188
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 45593227 - 45593284
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||||  ||||| ||||||||||||||||||| |||||| |||||    
45593227 aggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgt 45593284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #189
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 8905234 - 8905186
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||| |||||| ||||||||||| ||||| |||||    
8905234 ggctaaaatatggttttggtccctgtaaatatgcctcattttgatttta 8905186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #190
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 28809011 - 28809067
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||| ||||||||||  |||||||||||||||| |||||    
28809011 ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgt 28809067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 366 - 418
Target Start/End: Original strand, 31370803 - 31370855
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    ||||||||||||||||||  |  |||| |||||||||||||||||||||||||    
31370803 aggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagtt 31370855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 368 - 415
Target Start/End: Original strand, 7639897 - 7639944
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||| ||||| |||||||| || ||||||||||||    
7639897 gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta 7639944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 24474599 - 24474649
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||| ||||||||||| ||||||||||||||||    
24474599 aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagt 24474649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 5 - 88
Target Start/End: Complemental strand, 29551873 - 29551790
Alignment:
5 agtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttat 88  Q
    ||||| |||||| |||||||| |||| |||||||||||| |||||||| |||||   | ||||| ||||||||  |||||||||    
29551873 agtttagtgttcggatcaatgaccgaagtgtccatgattttttggtgtagtttactccttatgaaaacatacacactaatttat 29551790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 464
Target Start/End: Original strand, 54208480 - 54208559
Alignment:
386 tccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttgat 464  Q
    |||||||||||||||||| ||||||||||||| |||||         || |||||||||||| |||||||||||||||||    
54208480 tccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtctctgcaaaatattttgat 54208559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 2180572 - 2180522
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| |||||  |||||||||||||| | |||||||||||||||    
2180572 ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagt 2180522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 365 - 399
Target Start/End: Original strand, 9836830 - 9836864
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatg 399  Q
    |||||||||||||||||||||||| ||||||||||    
9836830 aaggctaaaatatggttttgatccttgcaaatatg 9836864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 18831176 - 18831122
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||| ||||||| || |||||||||||||| |||||    
18831176 ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgt 18831122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 30564835 - 30564889
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  ||||||||||||||  | |||||||||||||| |||||    
30564835 ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgt 30564889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 364 - 398
Target Start/End: Complemental strand, 33137290 - 33137256
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||||| |||||||||||||||||||    
33137290 taaggctaaaatatgtttttgatccctgcaaatat 33137256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 414
Target Start/End: Original strand, 36050359 - 36050393
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||| |||||||||||||||||||||||||||||    
36050359 ttttggtccctgcaaatatgcctcgttttggtttt 36050393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| |||||  | |||||||||||| |||||||||||||||||    
47274230 ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 47274180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 415
Target Start/End: Complemental strand, 52543725 - 52543679
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||| ||||| | | ||||||||||||||||||||||||||    
52543725 ctaaaatatgattttggttcttgcaaatatgcctcgttttggtttta 52543679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 55805088 - 55805038
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| |||||| | | ||||||||||||| ||||||||||||||    
55805088 ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagt 55805038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 398
Target Start/End: Original strand, 3879080 - 3879117
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatat 398  Q
    |||| ||||||||||||| |||||||||||||||||||    
3879080 tttttaggctaaaatatgcttttgatccctgcaaatat 3879117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #206
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 368 - 413
Target Start/End: Original strand, 25358213 - 25358258
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    ||||||||||| |||| |||| ||||||||||| ||||||||||||    
25358213 gctaaaatatgattttaatccatgcaaatatgcttcgttttggttt 25358258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #207
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 30890832 - 30890881
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||||||||||||||| ||  |||| ||||||||    
30890832 gctaaaatatggttatgatccctgcaaatatgtcttattttagttttagt 30890881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #208
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 399
Target Start/End: Original strand, 33134890 - 33134923
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatg 399  Q
    ||||||||||||| ||||||||||||||||||||    
33134890 aggctaaaatatgtttttgatccctgcaaatatg 33134923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #209
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 37556840 - 37556897
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||   || ||||||||| ||||| |||||||||||| |||||    
37556840 aggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgt 37556897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #210
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 304 - 345
Target Start/End: Complemental strand, 41508464 - 41508423
Alignment:
304 ggttacttgttcagcaagagtaacttattgaacatgtttttc 345  Q
    ||||||||| ||||||||||||||| || |||||||||||||    
41508464 ggttacttgctcagcaagagtaactcatggaacatgtttttc 41508423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #211
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 50754257 - 50754200
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||| ||||||| ||   |||||| ||||||||| |||||    
50754257 aggctaaaatatggttttgatcactgcaaacatatatcgtttaggttttagtccctgt 50754200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #212
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 7642652 - 7642596
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| || || || |||||||||||  |||||||||||||||| |||||    
7642652 ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgt 7642596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #213
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 9446323 - 9446267
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||  |||||| ||||||| |||||||||||||| || |||||    
9446323 ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgt 9446267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #214
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 370 - 418
Target Start/End: Original strand, 41920771 - 41920819
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    ||||||||||||||  |||||||||||||| ||| ||||| ||||||||    
41920771 taaaatatggttttagtccctgcaaatatgactcattttgattttagtt 41920819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 2e-22; HSPs: 239)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 43441605 - 43441507
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
43441605 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 43441507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 15979702 - 15979606
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||||        || ||||||||||||||||||||||||||||    
15979702 aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattttg 15979606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 45002020 - 45002076
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
45002020 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 45002076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 9603628 - 9603679
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
9603628 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 9603679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 365 - 459
Target Start/End: Original strand, 31480134 - 31480229
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
31480134 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 31480229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 19844583 - 19844485
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
19844583 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 19844485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 21159823 - 21159761
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
21159823 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 21159761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 25615973 - 25616031
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
25615973 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 25616031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 363 - 417
Target Start/End: Original strand, 46751267 - 46751321
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
46751267 ttaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 46751321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 51550452 - 51550350
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
51550452 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctgcaaaatatt 51550353  T
460 ttg 462  Q
    |||    
51550352 ttg 51550350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 4513258 - 4513319
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
4513258 tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 4513319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 361 - 422
Target Start/End: Complemental strand, 20612904 - 20612843
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
20612904 ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 20612843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 28552020 - 28552117
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||         || ||||||||||||||||||||||||||||    
28552020 aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttg 28552117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 47336582 - 47336485
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
47336582 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 47336485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 367 - 459
Target Start/End: Original strand, 49323782 - 49323875
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
49323782 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 49323875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 54608516 - 54608573
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
54608516 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 54608573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 54608864 - 54608767
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
54608864 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 54608767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 474409 - 474353
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
474409 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 474353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 4035053 - 4034997
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||    
4035053 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgt 4034997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 9261789 - 9261885
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
9261789 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttggtccctgcaaaatattttg 9261885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 9597099 - 9597039
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||    
9597099 ttaaggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgt 9597039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 14772205 - 14772261
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||    
14772205 ttttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt 14772261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 28552384 - 28552328
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
28552384 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28552328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 35407791 - 35407695
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||||||||||||||||| || ||||| |||||||| |||||        || ||||||||| ||||||||||||||||||    
35407791 aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgtaaaaaaatttgttgtttttgatccctgcaaaatattttg 35407695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 39288899 - 39288843
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
39288899 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 39288843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 362 - 422
Target Start/End: Original strand, 47336223 - 47336283
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
47336223 tttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 47336283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 51550081 - 51550137
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
51550081 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 51550137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 363 - 422
Target Start/End: Original strand, 3387261 - 3387320
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||    
3387261 ttaaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 3387320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 9262156 - 9262105
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
9262156 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 9262105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 365 - 459
Target Start/End: Complemental strand, 12741273 - 12741178
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
12741273 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 12741178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
22008890 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 22008835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 30128283 - 30128378
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||        || ||||||||||||||||| ||||||||||    
30128283 aggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgt-aaaaaaattgttgtttttggtccctgctaaatattttg 30128378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
43441270 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 43441325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 365 - 459
Target Start/End: Complemental strand, 45002387 - 45002292
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
45002387 aaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 45002292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 362 - 464
Target Start/End: Complemental strand, 45313868 - 45313765
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttatt-gtttttggtccctgcaaaatattt 460  Q
    |||| |||||||||||||||||| ||||||||||||||| |||||||| ||||||| |||||        || || ||||||||||||||||||||||||    
45313868 tttatggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaattttagtttttagtttttggtccctgcaaaatattt 45313769  T
461 tgat 464  Q
    ||||    
45313768 tgat 45313765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 48924243 - 48924184
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||    
48924243 taaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt 48924184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 474041 - 474099
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
474041 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 474099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 1721454 - 1721396
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||    
1721454 aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt 1721396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 4950035 - 4950093
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
4950035 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 4950093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 35565506 - 35565564
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||    
35565506 aaggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgt 35565564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 40370589 - 40370539
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||    
40370589 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 40370539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 47005525 - 47005423
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||| | |||         || |||||||||||||||||||||||||    
47005525 tttttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatatt 47005426  T
460 ttg 462  Q
    |||    
47005425 ttg 47005423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 51834605 - 51834663
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
51834605 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 51834663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 4513625 - 4513564
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
4513625 tttaaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgt 4513564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 8940527 - 8940470
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
8940527 aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8940470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 10977343 - 10977286
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||    
10977343 aaggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg 10977286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 12740901 - 12740962
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
12740901 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 12740962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 22008521 - 22008582
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
22008521 tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 22008582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 22016039 - 22016100
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
22016039 tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 22016100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 28427610 - 28427553
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
28427610 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 28427553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 29955667 - 29955610
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||    
29955667 aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 29955610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 30004822 - 30004765
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||    
30004822 aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 30004765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 30106221 - 30106164
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||    
30106221 aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt 30106164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 30130157 - 30130214
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
30130157 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 30130214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 32119586 - 32119529
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
32119586 aaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 32119529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 37507224 - 37507167
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
37507224 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37507167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 39437111 - 39437054
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
39437111 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 39437054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 3152112 - 3152056
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
3152112 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 3152056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 3387606 - 3387554
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| || |||||||||||||||||||||||||||||    
3387606 aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagt 3387554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 4034717 - 4034773
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
4034717 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 4034773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 364 - 416
Target Start/End: Original strand, 21553886 - 21553938
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| |||||||    
21553886 taaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag 21553938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 25609766 - 25609862
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| ||  | |||||| ||||||||||||||||||| |||||        || ||||||||||||||||||||||||||||    
25609766 aggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattttg 25609862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 25710870 - 25710814
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
25710870 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 25710814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 26090078 - 26090022
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
26090078 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 26090022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 37506866 - 37506922
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
37506866 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37506922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 44802282 - 44802338
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||| ||||||||||||||||||||||    
44802282 ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgt 44802338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 45320983 - 45320923
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
45320983 ttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 45320923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 3151749 - 3151800
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
3151749 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 3151800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 3830517 - 3830466
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
3830517 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 3830466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 454
Target Start/End: Complemental strand, 7957226 - 7957139
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaa 454  Q
    |||||||||||| ||||| ||||||||||||||| |||||||||||||||| |||||        || ||||||||||||||||||||    
7957226 ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgtaattttttttgttgtttttggtccctgcaaa 7957139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 365 - 459
Target Start/End: Original strand, 8940158 - 8940253
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||| |||||||||||||||||| |||||||||| |||||||||||||||||| |||||         || |||||||||||||||||||||||||    
8940158 aaggttaaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 8940253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
10976978 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 10977033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 11463233 - 11463288
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||    
11463233 gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgt 11463288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 15286155 - 15286206
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| |||||||||||||||| ||||||||||||||||    
15286155 aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagt 15286206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
15979338 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 15979393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
26089730 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 26089785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 29490744 - 29490693
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
29490744 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 29490693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||    
31480500 ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg 31480445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 364 - 423
Target Start/End: Complemental strand, 35569139 - 35569080
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
35569139 taaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 35569080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 362 - 417
Target Start/End: Original strand, 39288568 - 39288623
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||||  |||||||||||||| |||||||||||||||||    
39288568 tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 39288623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 188 - 350
Target Start/End: Complemental strand, 4159953 - 4159791
Alignment:
188 tccctcaccatataaagtaagaatttta--acagtcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatcattcgaa 285  Q
    ||||||||| || |||||| ||| ||||  |||||||||||||||||  ||  |||||| |||||||||| | ||   |||||  || |||| |||| ||    
4159953 tccctcaccctaaaaagtatgaactttatcacagtcttgaaccagtttcga--atataaaccaaacatttttgggatgtgttcacattatataattcaaa 4159856  T
286 atagttcagagtttcgatggttacttgttcagcaagagtaacttattgaacatgtttttctttgg 350  Q
    |||||||| ||||| |||| ||||||| | ||||||| ||||| |||||||| ||||||||||||    
4159855 atagttcaaagtttggatgattacttgcttagcaagactaactcattgaacacgtttttctttgg 4159791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 5345691 - 5345633
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
5345691 aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 5345633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 368 - 422
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
22156292 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 22156238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 25610134 - 25610080
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||||| |||||||||||||||||||||||| |||||||    
25610134 ttaaagctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagt 25610080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 28942908 - 28942850
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  | |||||||||||||||||||||||||||||| ||||    
28942908 taaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg 28942850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 30268503 - 30268561
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
30268503 aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 30268561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 35177253 - 35177311
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||| |||||||||||||| |||||||||||||||||| ||||    
35177253 aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctgt 35177311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 360 - 422
Target Start/End: Original strand, 39436711 - 39436773
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| |||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
39436711 gtttaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 39436773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 40545558 - 40545620
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||| |||||||||||||| |||||||| |||||||| |||||    
40545558 tttttaggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt 40545620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 415
Target Start/End: Complemental strand, 40979712 - 40979662
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||    
40979712 aaggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta 40979662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 47005152 - 47005210
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||| |||||||| |||||||| |||||    
47005152 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgt 47005210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 50196301 - 50196355
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
50196301 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 50196355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 363 - 417
Target Start/End: Complemental strand, 52342587 - 52342533
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||  || |||||||||||||||||||||||||||||    
52342587 ttaaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagt 52342533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 3830133 - 3830190
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||||||| ||||||||||||| |||||    
3830133 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt 3830190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 415
Target Start/End: Complemental strand, 9603920 - 9603871
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||    
9603920 aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta 9603871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 13584369 - 13584312
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  ||||||||||||||||| |||||||||||||| ||||    
13584369 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 13584312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 364 - 417
Target Start/End: Original strand, 20611017 - 20611070
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
20611017 taaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 20611070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 26799886 - 26799943
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||| ||||||||||||||||||||||||| ||||    
26799886 aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg 26799943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 29678022 - 29678118
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||| |||||| ||  |||||||||||||||||||||||||||| |||||        || ||||||||||||| ||||||||||||||    
29678022 aaggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgtaatttttatt-ttgtttttggtccttgcaaaatattttg 29678118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 30034473 - 30034416
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |||||    
30034473 aggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgt 30034416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 40169342 - 40169399
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| ||||||||||||||| ||||||||| ||||||| ||||    
40169342 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg 40169399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 52342194 - 52342243
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||    
52342194 aggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta 52342243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 3361824 - 3361768
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| ||||||||||||||||  ||||||||||||||||| ||||||||||||||    
3361824 ttttaaagctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 3361768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 9863404 - 9863348
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  || ||||||||||||||||||||||||||||| |||||    
9863404 ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt 9863348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 15016388 - 15016444
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||||| |||||||||||||| |||||    
15016388 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 15016444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 16123139 - 16123195
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||| ||||||||||||||||||||||||| |||||    
16123139 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt 16123195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 462
Target Start/End: Complemental strand, 20907454 - 20907362
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||| ||||||||||||||||||| |||||||||||||  ||||          ||||||||||||||||||||||| |||||    
20907454 taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttg 20907362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 28452377 - 28452321
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| ||||| ||||||||| |||||||||||||||| ||||    
28452377 aggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg 28452321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 418
Target Start/End: Original strand, 28942524 - 28942576
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    ||||||||||||||||||  ||||||||||||||||| |||||||||||||||    
28942524 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtt 28942576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 29445954 - 29446010
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
29445954 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 29446010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 29525099 - 29525155
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||  |||||||||||||| |||||||| ||||||||    
29525099 ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagt 29525155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 363 - 455
Target Start/End: Complemental strand, 36673249 - 36673157
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaa 455  Q
    |||| ||||||||||||||||| |||||||||||||| ||  |||||||||||||||| ||        || |||||||||||||||||||||    
36673249 ttaacgctaaaatatggttttggtccctgcaaatatgacttattttggttttagttcccgtaaaaaaatttgttgtttttggtccctgcaaaa 36673157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 40370285 - 40370341
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||| |||||||||||||| |||||||| ||||||||||||||    
40370285 ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgt 40370341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||||||||| ||||||||| ||||||| ||||    
45005889 taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg 45005941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 46186773 - 46186721
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||| ||||||||||||||||||||||||||||    
46186773 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 46186721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 47114485 - 47114537
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||| ||||| |||||||||||||| |||||||||||||||||    
47114485 aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 47114537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||| |  |||||||||||||||||||||||||||||||| ||||    
51500686 aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg 51500630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 51834943 - 51834887
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  ||||||||||||||| |||||||||||||||| ||||    
51834943 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 51834887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 53701663 - 53701607
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
53701663 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 53701607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 364 - 415
Target Start/End: Complemental strand, 2486905 - 2486854
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||| |||||||||||||||| ||||||||||||||| ||||||||||||||    
2486905 taagactaaaatatggttttggtccctgcaaatatgcttcgttttggtttta 2486854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 364 - 415
Target Start/End: Original strand, 4814537 - 4814588
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||  |||||||||||||| |||||||||||||||    
4814537 taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 4814588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 7588317 - 7588368
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| |||||| ||||||||||||||||| ||||||||||||||    
7588317 aggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagt 7588368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||||||| ||||||||||||| ||||    
8510214 ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg 8510269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 369 - 416
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||    
14633547 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag 14633594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 34238597 - 34238648
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
34238597 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 34238648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 35936773 - 35936828
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||||||||| ||||| ||||||| | ||||||||||||||    
35936773 gttttaaggctaaaatatggttttggtccctacaaatatacttcgttttggtttta 35936828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 50009284 - 50009189
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||| |||||||||| ||| |||||||||||||||||||| ||||| | |||||        || |||||||| |||||||||||||||||||    
50009284 ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaatttttgtttttgttttttgtccctgcaaaatattttg 50009189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 419
Target Start/End: Complemental strand, 7518444 - 7518394
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||  |||||||||||||| |||||||||||||||||||    
7518444 ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagttc 7518394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 12673642 - 12673700
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||  |||||| ||||||||||||||||||||||||| |||||    
12673642 aaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgt 12673700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 29686870 - 29686820
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| |||||||||||||||||| ||| ||||||||||||||||    
29686870 ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagt 29686820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 29955300 - 29955354
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||||||||||||||||||||| ||||||| |||||    
29955300 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 29955354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 30004454 - 30004508
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||||||||||||||||||||| ||||||| |||||    
30004454 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 30004508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 31869596 - 31869650
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| || |||||||||||| ||||||||||||||||| |||||    
31869596 ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgt 31869650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 363 - 417
Target Start/End: Original strand, 38232237 - 38232291
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||| ||||| |||||||||||||| ||||||||| |||||||    
38232237 ttaaggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagt 38232291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 415
Target Start/End: Original strand, 40277820 - 40277870
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||| |||||||| ||||||||||||||| ||||||||||||||    
40277820 aaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta 40277870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 411
Target Start/End: Complemental strand, 44802550 - 44802504
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggt 411  Q
    |||||||||||||| |||||||||||||||||||| |||||||||||    
44802550 aaggctaaaatatgattttgatccctgcaaatatgtctcgttttggt 44802504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 462
Target Start/End: Complemental strand, 45006247 - 45006153
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||| |||||  |||||||||||||||||||||||||||||| | |||||         || ||||||||||||||||||||||||||||    
45006247 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 45006153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 7518088 - 7518185
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||| ||  ||||||||||||||||||||||| |||||||| | |||         | |||||||||||||||||||||| |||||    
7518088 aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaaaaaaaagttttgtttttggtccctgcaaaattttttg 7518185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 20404889 - 20404946
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| | ||||||||||| ||||||| ||||||||||| ||||    
20404889 aggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagtttctgt 20404946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 22155923 - 22155984
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
22155923 tttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 22155984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 415
Target Start/End: Complemental strand, 27681683 - 27681634
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||| || || |||||||||||||||||||||||||||    
27681683 aggctaaaatatggttctggtctctgcaaatatgcctcgttttggtttta 27681634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 28452146 - 28452243
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| ||| |||||||||| || |||||||||||||| | |||         || ||||||||||||||||||||||||||||    
28452146 aggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 28452243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 31869957 - 31869900
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| |||||||| |||||||| |||||    
31869957 aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt 31869900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 32119219 - 32119316
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||| |||||| |||||||||||||| |||||||| |||||||| ||||          || ||||||||||||||||||||||||||||    
32119219 aggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 32119316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 369 - 461
Target Start/End: Original strand, 46724545 - 46724638
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnn-ttattgtttttggtccctgcaaaatatttt 461  Q
    |||||||||| ||||||||| |||||||||  |||||||| |||||||| |||||         ||||||||||||||||||||||||||||||    
46724545 ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaaatatttt 46724638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 50196658 - 50196601
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||||| ||||||||||||||||| |||||||| |||||    
50196658 aggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgt 50196601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 414
Target Start/End: Original strand, 53113441 - 53113490
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||||| |||||||||||||| ||||||||| ||||    
53113441 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt 53113490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 275443 - 275499
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  ||||||||| |||||||||||||| ||||||| ||||    
275443 aggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg 275499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 4322193 - 4322133
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||| |||||||| |||||| |||||||||||||| || |||||||||||||| |||||    
4322193 ttaaggttaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt 4322133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 4814904 - 4814849
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||  ||| |||||||||| |||||||||||||||||    
4814904 ttttaaggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagt 4814849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 19656539 - 19656591
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||| |||||||||||||||||||| |||||||    
19656539 aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagt 19656591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 19844265 - 19844321
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||||| |||||||||||||||||  ||||||| |||||    
19844265 ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgt 19844321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 20757781 - 20757725
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||| |||| ||||||| |||||||| ||||||||||||||||    
20757781 tttttaggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagt 20757725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 21159451 - 21159503
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| |||||||    
21159451 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 21159503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 28427244 - 28427300
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  | |||||||||||| ||||||||||||||||| ||||    
28427244 aggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg 28427300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 363 - 423
Target Start/End: Original strand, 29686540 - 29686600
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| |||||||||||| ||| |||||||||| || |||||||||||||| |||||    
29686540 ttaaggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgt 29686600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 34238917 - 34238865
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||| |||||||||| ||||||||||||||||    
34238917 aaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagt 34238865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 46622130 - 46622074
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| ||| ||||||||||  |||||||||||||||| ||||    
46622130 aggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg 46622074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 370 - 422
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||| ||||||| ||||||||||||||||| ||||    
49324143 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg 49324091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 368 - 416
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||||||||||||| |  |||||||||||||||||||||||||||||||    
51760117 gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag 51760069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 8555305 - 8555258
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| ||| ||||||||||| ||||||||||||||||    
8555305 taaaatatggttttggtccatgcaaatatgcatcgttttggttttagt 8555258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 9596759 - 9596814
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  || |||||||||||| |||||||||||||||| |||||    
9596759 gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgt 9596814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 13514578 - 13514527
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| ||||| | |||||||||||| |||||||||||||||||    
13514578 aggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagt 13514527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Original strand, 20757403 - 20757450
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||| ||||  ||||||||||||||||||||||||||||||||    
20757403 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 20757450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 29446207 - 29446156
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| || ||||||||||||||    
29446207 aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt 29446156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
40169654 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 40169599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 863654 - 863596
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||| ||||||||||||||  |||||||| ||||||| |||||    
863654 aaggttaaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgt 863596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 1721083 - 1721145
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||| ||||||||||||||| ||| |||||||||| ||| ||||||||||||| |||||    
1721083 tttttaggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgt 1721145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 419
Target Start/End: Original strand, 2486581 - 2486631
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||  |||||||||||||| ||| |||||||||||||||    
2486581 ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagttc 2486631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 188 - 350
Target Start/End: Complemental strand, 4144141 - 4143979
Alignment:
188 tccctcaccatataaagtaagaattttaaca--gtcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatcattcgaa 285  Q
    ||||||||| || |||||| ||| |||||||  |||||||||| ||||  |  |||||| |||||||||| | ||   |||||  || |||| |||| ||    
4144141 tccctcaccctaaaaagtatgaactttaacaaggtcttgaaccggttccaa--atataaaccaaacatttttgggatgtgttcacattatataattcaaa 4144044  T
286 atagttcagagtttcgatggttacttgttcagcaagagtaacttattgaacatgtttttctttgg 350  Q
    ||||| || ||||| |||| ||||||| | ||||||| ||||| |||||||| ||||||||||||    
4144043 atagtccaaagtttggatgattacttgcttagcaagactaactcattgaacacgtttttctttgg 4143979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 10778368 - 10778426
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||  |  ||||||||||||||||||||| |||||||||||||    
10778368 aaggttaaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgt 10778426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 20644878 - 20644820
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||| |||||| || ||||||| ||||||| |||||    
20644878 aaggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgt 20644820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 368 - 462
Target Start/End: Complemental strand, 28418899 - 28418805
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||| ||||||||||||||  | |||||| ||||||| |||||        || |||||||||||| ||| |||||||||||    
28418899 gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgtaatttttgttgttgtttttggtctctgtaaaatattttg 28418805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 415
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||| ||| || |||||||||||||||||||||||    
30034109 ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta 30034155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 51759817 - 51759875
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| |  | |||||||||||| ||||||||||||||||| |||||    
51759817 aaggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgt 51759875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 367 - 420
Target Start/End: Complemental strand, 275833 - 275780
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc 420  Q
    |||||||||||| ||||  |||||| |||||||| |||||||||||||||||||    
275833 ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttcc 275780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 863280 - 863377
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||| ||||| ||| |||||||||| |||||||| ||||||||  ||||         || ||||||||||||||||||||||||||||    
863280 aggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 863377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 4321945 - 4321994
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||| |||||| |||||||||| ||| |||||||||||    
4321945 aggctaaaatatggttctgatccttgcaaatatgtctcattttggtttta 4321994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 417
Target Start/End: Complemental strand, 11463480 - 11463431
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| | || ||||||| |||||||||||||||||||||    
11463480 gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagt 11463431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #180
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 14633891 - 14633834
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||| |||||||||  |||||||||||||| || |||||||||||||| ||||    
14633891 aaggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg 14633834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #181
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 20405224 - 20405167
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| ||||||||||||| | | ||||| |||||||| |||||    
20405224 aggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgt 20405167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #182
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 25710509 - 25710566
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||| ||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
25710509 aggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 25710566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #183
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 367 - 416
Target Start/End: Complemental strand, 29678387 - 29678338
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||||||||||| ||||| ||||||||||||||||  |||||||||||||    
29678387 ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttag 29678338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #184
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 364 - 417
Target Start/End: Complemental strand, 30130507 - 30130454
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||| ||||||||||||  || ||||||||||||||| |||||||||||||    
30130507 taaggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagt 30130454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #185
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 30552480 - 30552423
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||| |||||  ||| |||||||||| ||||||||||||||||| ||||    
30552480 aaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg 30552423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #186
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 40545836 - 40545783
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| ||||| |||||||||||||| ||| ||||||||||||| |||||    
40545836 taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgt 40545783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #187
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 45521841 - 45521780
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||| ||||||||||||||  ||  ||||||||||  ||||||||||||||||||||||    
45521841 tttaaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt 45521780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #188
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 46186410 - 46186459
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| ||||  |||||||||||||||||||||||| |||||||    
46186410 gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagt 46186459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #189
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 46901103 - 46901160
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  || |||||||||||  ||||||||||||||||| ||||    
46901103 aggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagtttctgt 46901160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #190
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 409
Target Start/End: Complemental strand, 53113757 - 53113716
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttg 409  Q
    ||||||||||||||||||||| ||||||||| ||||||||||    
53113757 gctaaaatatggttttgatccatgcaaatatacctcgttttg 53113716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 12673985 - 12673925
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||| ||||||||| ||||  | |||||||||||||||| |||||||||||||| ||||    
12673985 ttaaggttaaaatatgattttagttcctgcaaatatgcctcattttggttttagtttctgt 12673925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #192
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 20644505 - 20644561
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| |||||| |||||||||||||| ||| ||||| ||||||| |||||    
20644505 ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgt 20644561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #193
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 371 - 423
Target Start/End: Complemental strand, 21971046 - 21970994
Alignment:
371 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||| || |||||||||||||||||| |||||||| ||||    
21971046 aaaatatggttttaatctctacaaatatgcctcgttttgattttagtttctgt 21970994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #194
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 371 - 423
Target Start/End: Complemental strand, 21993482 - 21993430
Alignment:
371 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||| || |||||||||||||||||| |||||||| ||||    
21993482 aaaatatggttttaatctctacaaatatgcctcgttttgattttagtttctgt 21993430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #195
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 409
Target Start/End: Original strand, 25353197 - 25353241
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttg 409  Q
    ||||||| |||||||||||  ||||||||||||||||||||||||    
25353197 aaggctagaatatggttttagtccctgcaaatatgcctcgttttg 25353241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #196
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 363 - 419
Target Start/End: Original strand, 27200434 - 27200490
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||| |||||||||||||| ||||||||||||||  ||| |||| ||||||||||    
27200434 ttaaggttaaaatatggttttaatccctgcaaatatatctcattttagttttagttc 27200490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #197
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 364 - 416
Target Start/End: Original strand, 35533276 - 35533328
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||| |||||||||||||||| || ||||||||||| || |||||||||||||    
35533276 taagactaaaatatggttttggtctctgcaaatatgtcttgttttggttttag 35533328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #198
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 363 - 423
Target Start/End: Original strand, 36732636 - 36732696
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||| ||||||| ||||||| |||||||||||||| ||  |||||||||||||| ||||    
36732636 ttaaggttaaaataaggttttggtccctgcaaatatgtcttattttggttttagtttctgt 36732696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #199
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 39072213 - 39072165
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||  | |||||||||||||||||||||| |||||    
39072213 ggctaaaatatggttttagttcctgcaaatatgcctcgttttgatttta 39072165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #200
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 43440493 - 43440545
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||| |||||||||| |||||||| ||||||||    
43440493 aaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagt 43440545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #201
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 43440785 - 43440737
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||  ||||  ||||||||||||||||||||||||||||||||    
43440785 ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagt 43440737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #202
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 45161107 - 45161163
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| | |||||||||||||   |||||||||||||| |||||||||||||||||    
45161107 ttttaaagttaaaatatggtttaagtccctgcaaatatgtctcgttttggttttagt 45161163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #203
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
367 ggctaaaatatggttttgatccc-tgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||| ||||||||||| |||||||||||||||| ||||    
49670803 ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg 49670747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #204
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 52956383 - 52956479
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnt-tattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||  ||||| ||||| | |||||| ||||||||||||||||||| |||        | | ||||||||||||||||||||||||||||    
52956383 ggctaaaatatacttttggtccctactaatatgtctcgttttggttttagttcatgtaaaaaaaatgtgttgtttttggtccctgcaaaatattttg 52956479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #205
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 53701361 - 53701417
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| ||| ||||||||||||||  |||| |||||||| |||||    
53701361 ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgt 53701417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #206
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 370 - 417
Target Start/End: Original strand, 9863050 - 9863096
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||  ||||||||| ||||||||||||||||||||||    
9863050 taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagt 9863096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #207
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 419
Target Start/End: Complemental strand, 16123481 - 16123450
Alignment:
388 cctgcaaatatgcctcgttttggttttagttc 419  Q
    ||||||||||||||||||||||||||||||||    
16123481 cctgcaaatatgcctcgttttggttttagttc 16123450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #208
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 362 - 405
Target Start/End: Complemental strand, 26273829 - 26273786
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgt 405  Q
    ||||||||||||||||||||||  |||| |||||||||||||||    
26273829 tttaaggctaaaatatggttttagtcccagcaaatatgcctcgt 26273786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #209
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 363 - 422
Target Start/End: Original strand, 34582520 - 34582579
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  ||| |||||||||||||| |  |||||||||||||| ||||    
34582520 ttaaggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg 34582579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #210
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 370 - 417
Target Start/End: Original strand, 36672966 - 36673013
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| || ||||||||||| || ||||||||||||||    
36672966 taaaatatggttttggtctctgcaaatatgtcttgttttggttttagt 36673013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #211
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 46724901 - 46724846
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||  | |||||| ||||||| |||||    
46724901 gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgt 46724846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #212
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 51500397 - 51500448
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||| |  || ||| |||||||||||||||||||||||||    
51500397 aggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagt 51500448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #213
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 414
Target Start/End: Original strand, 20644578 - 20644612
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||||| ||||||||||||||    
20644578 ttttgatccctgcaaatatgtctcgttttggtttt 20644612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #214
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 30424628 - 30424678
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  |||||||||||||| || ||||| ||||||||    
30424628 ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagt 30424678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #215
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 30426226 - 30426177
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||| |||||||||||||||||||| |||||||    
30426226 ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagt 30426177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #216
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 399
Target Start/End: Complemental strand, 39132912 - 39132874
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatg 399  Q
    |||| ||||||||||||||||||| ||||||||||||||    
39132912 tttttaggctaaaatatggttttggtccctgcaaatatg 39132874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #217
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 415
Target Start/End: Original strand, 46621778 - 46621824
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||| ||||||||||| ||||||||||||| |||| ||||||    
46621778 ctaaaatattgttttgatcccagcaaatatgcctcattttagtttta 46621824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #218
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 376 - 418
Target Start/End: Complemental strand, 52956691 - 52956649
Alignment:
376 atggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    ||||||||| || |||||||||||| |||||||||||||||||    
52956691 atggttttggtctctgcaaatatgcatcgttttggttttagtt 52956649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #219
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 417
Target Start/End: Original strand, 590197 - 590226
Alignment:
388 cctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||||||||||||    
590197 cctgcaaatatgcctcgttttggttttagt 590226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #220
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 422
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
373 aatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||  ||||||||||||||  |||||||||||||||| ||||    
8510523 aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 8510474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #221
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 398
Target Start/End: Complemental strand, 20585709 - 20585672
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatat 398  Q
    |||| ||||||||||||| |||||||||||||||||||    
20585709 tttttaggctaaaatatgtttttgatccctgcaaatat 20585672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #222
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 414
Target Start/End: Complemental strand, 25610061 - 25610024
Alignment:
377 tggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||| |||||||||||||| ||||||||||||||    
25610061 tggttttggtccctgcaaatatgtctcgttttggtttt 25610024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #223
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 370 - 415
Target Start/End: Complemental strand, 35177563 - 35177518
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||| |||| ||||||||||| || |||||||||||    
35177563 taaaatatggttttcatccttgcaaatatgcttccttttggtttta 35177518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #224
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 380 - 417
Target Start/End: Original strand, 35565581 - 35565618
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||| |||||||||||||||||| |||||||||||||    
35565581 ttttggtccctgcaaatatgcctcattttggttttagt 35565618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #225
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 365 - 418
Target Start/End: Complemental strand, 40279337 - 40279284
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 418  Q
    |||||||||||||||||||| ||  |||||||||| || |||||| ||||||||    
40279337 aaggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagtt 40279284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #226
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 47114804 - 47114747
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||||| ||| |||||||||   ||||||| ||||||||||||||    
47114804 aggctaaaatatagttttggtccttgcaaatatatttcgttttagttttagttcctgt 47114747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #227
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 54767524 - 54767471
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||| |||||  ||||||| ||||||||| ||||||| |||||    
54767524 taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgt 54767471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #228
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Original strand, 976779 - 976811
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||| |||||||||||||||||||    
976779 aggctaaaatatgcttttgatccctgcaaatat 976811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #229
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 362 - 398
Target Start/End: Original strand, 3416490 - 3416526
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||||||| |||||||||||| ||||||    
3416490 tttaaggctaaaatatgattttgatccctgtaaatat 3416526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #230
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 399
Target Start/End: Original strand, 4705681 - 4705713
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatg 399  Q
    |||||||||||| ||||||||||||||||||||    
4705681 ggctaaaatatgcttttgatccctgcaaatatg 4705713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #231
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 16679678 - 16679726
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||  ||| || |||||||| ||||||||||||||||    
16679678 ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagt 16679726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #232
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 375 - 423
Target Start/End: Original strand, 29490377 - 29490425
Alignment:
375 tatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| ||||| |||||||||  ||||||||||||||| |||||    
29490377 tatggttttggtccctacaaatatgcaccgttttggttttagtccctgt 29490425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #233
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 373 - 413
Target Start/End: Complemental strand, 38232594 - 38232554
Alignment:
373 aatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||| | |||||||||||| |||||||||||||    
38232594 aatatggttttggtacctgcaaatatgtctcgttttggttt 38232554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #234
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Complemental strand, 39820664 - 39820632
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||||||||| |||||||||||||    
39820664 aggctaaaatatggttttggtccctgcaaatat 39820632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #235
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Complemental strand, 47433869 - 47433837
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||||||||| |||||||||||||    
47433869 aggctaaaatatggttttggtccctgcaaatat 47433837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #236
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 47901798 - 47901850
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||  || ||| |||||||| ||||||||||||||||    
47901798 aaggttaaaatatggttttagtctctggaaatatgcatcgttttggttttagt 47901850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #237
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 47902145 - 47902089
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||| |||||  |||| |||||||||| | |||||||||||||| |||||    
47902145 ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgt 47902089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #238
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 363 - 399
Target Start/End: Original strand, 52401013 - 52401049
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatg 399  Q
    |||||||||||||||| ||||| ||||||||||||||    
52401013 ttaaggctaaaatatgtttttggtccctgcaaatatg 52401049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #239
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 362 - 398
Target Start/End: Original strand, 53121297 - 53121333
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||||||| ||||| |||||||||||||    
53121297 tttaaggctaaaatatgtttttggtccctgcaaatat 53121333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 207)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 24507845 - 24507747
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
24507845 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttg 24507747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 15058768 - 15058671
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||        || |||||||||||||| |||||||||||||    
15058768 aaggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttcatgtaaaaaaaattgttgtttttggtcccggcaaaatattttg 15058671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 364 - 462
Target Start/End: Complemental strand, 12360971 - 12360872
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
12360971 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg 12360872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
24507479 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 24507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 3247196 - 3247294
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
3247196 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 3247294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 19623020 - 19622962
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
19623020 taaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 19622962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 19720710 - 19720808
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
19720710 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 19720808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 33045692 - 33045634
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
33045692 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 33045634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 35307713 - 35307771
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
35307713 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 35307771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 38164297 - 38164199
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
38164297 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 38164199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 47819598 - 47819500
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
47819598 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 47819500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 8140433 - 8140530
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
8140433 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 8140530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 361 - 422
Target Start/End: Complemental strand, 8140805 - 8140744
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||    
8140805 ttttaaggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg 8140744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 367 - 459
Target Start/End: Complemental strand, 38151212 - 38151119
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
38151212 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 38151119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 24653802 - 24653898
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
24653802 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 24653898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 29688430 - 29688378
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
29688430 aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 29688378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 47819231 - 47819287
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
47819231 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 47819287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 52254181 - 52254233
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
52254181 aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 52254233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 29072494 - 29072553
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
29072494 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 29072553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 44157696 - 44157751
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
44157696 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 44157751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 1810925 - 1810983
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
1810925 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 1810983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 367 - 464
Target Start/End: Original strand, 10631164 - 10631262
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttgat 464  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||| |||||||||||||||    
10631164 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgat 10631262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 15526364 - 15526266
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
15526364 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 15526266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 17129691 - 17129745
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| |||||    
17129691 ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgt 17129745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 18302393 - 18302331
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
18302393 ttttgaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 18302331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 18899833 - 18899895
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||| ||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
18899833 ttttaaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 18899895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 30322927 - 30323025
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
30322927 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 30323025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 31061154 - 31061096
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||||||||||||||  ||||||||||||||||| ||||    
31061154 taaggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg 31061096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 32626527 - 32626585
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
32626527 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 32626585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 32729052 - 32728994
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
32729052 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 32728994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 33234544 - 33234602
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||    
33234544 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 33234602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 45368488 - 45368546
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
45368488 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 45368546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 422
Target Start/End: Complemental strand, 3247568 - 3247507
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
3247568 tttttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3247507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 10631530 - 10631473
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
10631530 aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 10631473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 10887599 - 10887502
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||| |         || ||||||||||||||||||||||||||||    
10887599 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattttg 10887502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 13770488 - 13770545
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
13770488 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 13770545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 22919683 - 22919740
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
22919683 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 22919740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 26061954 - 26062011
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
26061954 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 26062011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 26324584 - 26324641
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||    
26324584 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt 26324641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 367 - 459
Target Start/End: Original strand, 33000305 - 33000398
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||         || |||||||||||||||||||||||||    
33000305 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 33000398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 33000671 - 33000614
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
33000671 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33000614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 38163929 - 38163986
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
38163929 aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38163986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 39747836 - 39747779
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
39747836 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 39747779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 45638895 - 45638798
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||| |         || ||||||||||||||||||||||||||||    
45638895 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcctataaaaaaaaattgttgtttttggtccctgcaaaatattttg 45638798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 990380 - 990324
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
990380 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 990324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 11822002 - 11822054
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
11822002 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 11822054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 15516581 - 15516637
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||    
15516581 aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg 15516637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 16026939 - 16026883
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||    
16026939 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 16026883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 16060885 - 16060829
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||    
16060885 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 16060829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 18473271 - 18473327
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
18473271 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 18473327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 18473597 - 18473545
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
18473597 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 18473545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 30323294 - 30323238
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
30323294 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 30323238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 33379886 - 33379938
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
33379886 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 33379938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 35005750 - 35005694
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
35005750 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 35005694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 35056530 - 35056626
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
35056530 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 35056626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 35056895 - 35056839
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
35056895 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 35056839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 35308111 - 35308055
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
35308111 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 35308055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 40718110 - 40718206
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
40718110 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 40718206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
41358368 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 41358424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 41358664 - 41358608
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||||||||    
41358664 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 41358608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 45380271 - 45380327
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
45380271 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 45380327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 45380636 - 45380540
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
45380636 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 45380540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 372 - 423
Target Start/End: Original strand, 2939934 - 2939985
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||||||||||||||||||||||||||||||| |||||    
2939934 aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt 2939985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 3753214 - 3753269
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
3753214 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 3753269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
7001897 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 7001842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 7819104 - 7819053
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| ||| |||||||||||||||||||||||||||||    
7819104 aggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagt 7819053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 12361008 - 12361067
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||  ||||||||||| |||||||||||||||||||| |||||    
12361008 taaggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgt 12361067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 365 - 416
Target Start/End: Complemental strand, 24654169 - 24654118
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||    
24654169 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag 24654118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
24977778 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 24977833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 363 - 422
Target Start/End: Original strand, 31258335 - 31258394
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||  |||||| ||||||||||||||||||||||||| ||||    
31258335 ttaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg 31258394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
38136981 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 38136926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 462
Target Start/End: Complemental strand, 39025381 - 39025287
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||| ||||||||||||||||||||| ||| |        || ||||||||||||||||||| ||||||||    
39025381 ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccctataaaaaaaattgttgtttttggtccctgcaagatattttg 39025287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
45638580 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 45638635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||    
46868577 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg 46868522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 990085 - 990143
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  ||||| |||||||||||||||||||||||||| ||||    
990085 taaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 990143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 3679624 - 3679682
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||| |||||||||||||||||||||||||| |||||    
3679624 aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 3679682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 3753574 - 3753516
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||| ||||||||||||||||||||||||| |||||    
3753574 aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt 3753516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 4789310 - 4789364
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
4789310 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 4789364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 6567498 - 6567440
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
6567498 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 6567440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 24978124 - 24978066
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| |||||| |||  |||||||||||||||||||||||||||||||||    
24978124 aaggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgt 24978066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 26442901 - 26442843
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
26442901 aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgt 26442843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 419
Target Start/End: Complemental strand, 42483277 - 42483219
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||||||||||||||| ||||||||||||||| | ||||||||||| ||||    
42483277 ttttaaggctaaaatatggttttggtccctgcaaatatgctttgttttggttttggttc 42483219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 7350417 - 7350518
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattt 460  Q
    |||||||| ||||||||||||||  |||||||||||||| ||| ||||||||||||| | | |        || ||||||||||||||||||||||||||    
7350417 ttttaaggttaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttataaaaaaaattgttgtttttggtccctgcaaaatattt 7350516  T
461 tg 462  Q
    ||    
7350517 tg 7350518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 461
Target Start/End: Original strand, 8364614 - 8364711
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    |||| ||||||||||||||||||||||||||||||  ||||||||||||||||  ||||         || |||||||||||||||||||||||||||    
8364614 aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaatttttttttgttgtttttggtccctgcaaaatatttt 8364711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 10887227 - 10887288
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||||||| ||||||||||||||  |||||||||||||||| ||||    
10887227 tttttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 10887288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 14007488 - 14007545
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
14007488 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 14007545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 15058419 - 15058468
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| |||||||||||||| |||||||||||||||||    
15058419 gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagt 15058468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 461
Target Start/End: Original strand, 15211509 - 15211606
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    |||||||||||||||||||| |||||| ||||||| |||||||||||||||||  ||||         || |||||||||||||||||||||||||||    
15211509 aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaaatttttgttgttgtttttggtccctgcaaaatatttt 15211606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 15335292 - 15335239
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||| ||||  ||||||||||||||||||||||||||||||||||||||    
15335292 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgt 15335239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 21391095 - 21391152
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
21391095 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 21391152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 416
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||    
24649350 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag 24649399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 367 - 456
Target Start/End: Original strand, 25658014 - 25658103
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaat 456  Q
    |||||||||||||||||| |||| ||||||||| ||||||||||||||| | |||||        || ||||||||||||||||||||||    
25658014 ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgtaaaaaaatttgttgtttttggtccctgcaaaat 25658103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 32454295 - 32454238
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  ||||||||||||||||||||||||| |||||| |||||    
32454295 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgt 32454238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 33045354 - 33045411
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| |||||||| ||||||||||||||||| |||||||||||||| |||||    
33045354 aggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgt 33045411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 462
Target Start/End: Complemental strand, 34002942 - 34002845
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||  |||||||||||||| || |||||||||||||| |||||        || ||| ||||||||||| ||||||||||||    
34002942 aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgtaaatttttttgttggttttggtccctacaaaatattttg 34002845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 35005442 - 35005499
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
35005442 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 35005499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 37545622 - 37545683
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||| |||||||||||||||||  ||| |||||||||||||||||||||||||||| ||||    
37545622 ttttatggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg 37545683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 38150846 - 38150903
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
38150846 aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 38150903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 44641079 - 44641128
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||||    
44641079 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 44641128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 44641437 - 44641376
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| |||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
44641437 tttatggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 44641376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 45290455 - 45290512
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
45290455 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 45290512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 50429210 - 50429153
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
50429210 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 50429153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 50799129 - 50799186
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||||||| ||||||||||||| |||||    
50799129 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt 50799186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 12322970 - 12322922
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||    
12322970 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 12322922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 13260322 - 13260266
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
13260322 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 13260266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 16060594 - 16060645
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||||||    
16060594 aaggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagt 16060645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 17984331 - 17984383
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||   ||||||||||||||||||||||||||||||||    
17984331 aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagt 17984383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 19622649 - 19622705
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
19622649 tttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 19622705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
19721071 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 19721019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 22953556 - 22953500
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||| ||||||    
22953556 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagatcctgt 22953500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 29072862 - 29072806
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||||||| |||||||||||| |||||    
29072862 ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgt 29072806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 31060787 - 31060883
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg-tnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||| |||||||||||||| || |||||||||||||| ||||          || ||||||||||||||||||||||||||||    
31060787 ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 31060883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 33234912 - 33234856
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||    
33234912 ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgt 33234856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 41738796 - 41738852
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||||||| |||| |||||||| |||||    
41738796 ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgt 41738852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 463
Target Start/End: Original strand, 42482978 - 42483077
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt--nnnnnnnnttattgtttttggtccctgcaaaatattttga 463  Q
    ||||||||||||||||||| |||||||||||||| ||| |||||||||||||  ||||          || |||||||||||||||||||||||||||||    
42482978 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttga 42483077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 44158044 - 44157992
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||||| ||||||||||||||    
44158044 aaggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagt 44157992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 45290821 - 45290765
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||  |||| ||||||||||||||||||||||||||| ||||    
45290821 aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 45290765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 369 - 417
Target Start/End: Original strand, 46183686 - 46183734
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||||||    
46183686 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt 46183734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 48956066 - 48956010
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||||| |||||||||||||| |||||    
48956066 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 48956010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 52254479 - 52254423
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||| ||||||| |||||    
52254479 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 52254423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 7818783 - 7818838
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| |||||  ||||||||||||||||||||||||||||||||| ||||    
7818783 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtttctgt 7818838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 19198948 - 19198893
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| ||||||||||||||| ||||| ||||||| |||||    
19198948 gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgt 19198893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 363 - 422
Target Start/End: Original strand, 41881089 - 41881148
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||  ||||| |||||||| ||||||||||||||||| ||||    
41881089 ttaaggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg 41881148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 48609595 - 48609544
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
48609595 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 48609544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 48955713 - 48955764
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| ||||  ||||||||||||||||||||||||||||||||    
48955713 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 48955764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 5058994 - 5058936
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||| |||||| ||||||||||||||||| ||||||| |||||    
5058994 aaggttaaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgt 5058936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 7867359 - 7867301
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||| |||||||||||||| ||  ||||||||||||| |||||    
7867359 aaggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgt 7867301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 12322604 - 12322654
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||||||||||||  |||||||| |||||||    
12322604 ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagt 12322654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 366 - 416
Target Start/End: Original strand, 12360602 - 12360652
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    ||||||||||||||||||| |||||||||||||||||| |||| |||||||    
12360602 aggctaaaatatggttttggtccctgcaaatatgcctcattttagttttag 12360652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 413
Target Start/End: Complemental strand, 15211858 - 15211812
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||| ||| ||||||||||||||||||||||||    
15211858 ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttt 15211812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 415
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||    
17130081 ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 17130035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 17984701 - 17984651
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| ||||  ||||||||||||||||||||||||||||||||    
17984701 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 17984651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 18079396 - 18079454
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||||| ||| |||||||||||||| ||||||||||||| |||||    
18079396 aaggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgt 18079454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 18928148 - 18928046
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||| ||||||||||||||||| || ||||||||||| ||| |||| |||||||| || ||         ||||||||||||||||||||||||||||    
18928148 ttttaaagctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaacatttttttattgtttttggtccctgcaaaatatt 18928049  T
460 ttg 462  Q
    |||    
18928048 ttg 18928046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 25658299 - 25658245
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||  |||||||||||||||||||||||||||||| ||||||| |||||    
25658299 ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgt 25658245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 26191359 - 26191409
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||||||||||||| ||||||||||||||||    
26191359 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 26191409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 26191734 - 26191684
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
26191734 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 26191684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 26207280 - 26207334
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||| ||| |||||||||| ||||||||||||||||| |||||    
26207280 ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt 26207334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 26442563 - 26442613
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
26442563 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 26442613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 368 - 422
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||    
32420099 gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 32420153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 364 - 414
Target Start/End: Original strand, 37624743 - 37624793
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||||||||| |  |||||||||||||||||||||||||||||    
37624743 taaggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt 37624793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 423
Target Start/End: Original strand, 48609234 - 48609292
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  |||| ||||||||| ||||||||||||||||| |||||    
48609234 aaggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgt 48609292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 365 - 415
Target Start/End: Original strand, 49073689 - 49073739
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||| ||| |||||||||| |||||||||||||||    
49073689 aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 49073739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 4323829 - 4323878
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||  |||||||||||||||||||||||| |||||||    
4323829 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt 4323878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 11822366 - 11822309
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
11822366 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgt 11822309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 13259987 - 13260044
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  || ||||||||||| ||||||||||||||||| |||||    
13259987 aggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgt 13260044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 370 - 423
Target Start/End: Complemental strand, 18900130 - 18900077
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
18900130 taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt 18900077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 24649661 - 24649604
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| |||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
24649661 aggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 24649604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||  |||||||||||||||||||||||| ||||||| |||||    
3679986 ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt 3679930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 4565337 - 4565241
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||| || |||||||||||||| ||||||||  ||||||| |||||        || ||||||||||||| ||||||||| ||||    
4565337 aggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgtaaatttttttgttgtttttggtccttgcaaaataatttg 4565241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 32 - 206
Target Start/End: Original strand, 15500118 - 15500289
Alignment:
32 gtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtgtgtcgtggatcacaaaatatgtcggtgcaa 131  Q
    ||||||||| | |||||||||||||||||  |||||| ||||  ||| | |||||||||||| || |||||||||| || |||  ||  ||||||| |||    
15500118 gtgtccatggtgatttggtgtggtttaaacaatatgaaaacaagcaaacaaatttatagaagtttttgtgtgtcgtagaccacctaaactgtcggtacaa 15500217  T
132 gacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttgagccctccctcaccatataaagta 206  Q
      |   || | |||| |||||| ||| ||||| |||| ||| ||  |||||| ||||||||||||||||||||||    
15500218 tgc---cacataaaatatcatgtacttaataggttcatattttaacatttgaaccctccctcaccatataaagta 15500289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 16026571 - 16026623
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||  ||||| ||||||||||||| ||||||||||||||||||    
16026571 aaggctaaaatataattttggtccctgcaaatatccctcgttttggttttagt 16026623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 409
Target Start/End: Complemental strand, 18079662 - 18079618
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttg 409  Q
    |||||||||||||||||||  ||||||||||||||||||||||||    
18079662 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttg 18079618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 20948755 - 20948811
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||||| |||||||| ||||||| ||||||||| |||||    
20948755 ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgt 20948811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 370 - 422
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||  ||||||||||||||||||||||| |||||||| ||||    
31258699 taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg 31258647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 417
Target Start/End: Original strand, 32035442 - 32035486
Alignment:
373 aatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| ||||||||||| |||||||||||||||||    
32035442 aatatggttttgatctctgcaaatatgtctcgttttggttttagt 32035486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 369 - 417
Target Start/End: Complemental strand, 48730615 - 48730567
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||| ||| ||||||||||||||||||| ||||||||    
48730615 ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagt 48730567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 7350733 - 7350686
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| || |||||||||| ||||||||||||||||||    
7350733 taaaatatggttttggtcactgcaaatatacctcgttttggttttagt 7350686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||  || |||||||||||| |||||||||||||||| ||||    
12158690 ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg 12158745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 22674202 - 22674253
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| | ||| |||||||||| |||||||||||||||||    
22674202 aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagt 22674253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 22919978 - 22919927
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  || |||||||||||||||||||| ||||||||    
22919978 aggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagt 22919927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 26324948 - 26324897
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||| ||||  ||| ||||||||||||||||||||||||||||    
26324948 aggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagt 26324897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #163
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 27521577 - 27521632
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
27521577 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 27521632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #164
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 409
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttg 409  Q
    ||||||||||||||||||| |||||||||||||| |||||||||    
36912852 aggctaaaatatggttttggtccctgcaaatatgtctcgttttg 36912895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #165
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 39303675 - 39303730
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||  ||||||||| |||| ||||||||||||||||| |||||    
39303675 gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgt 39303730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #166
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 363 - 422
Target Start/End: Original strand, 39747470 - 39747528
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||| ||| |||||||| | ||||||||||||||||| ||||    
39747470 ttaaggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg 39747528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #167
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 367 - 422
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||||||||||||| | |||||| ||||||| ||||    
40718474 ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg 40718419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #168
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 361 - 423
Target Start/End: Original strand, 7867123 - 7867185
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  ||| |||||||||| |||||||| |||||||| |||||    
7867123 tttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt 7867185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #169
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||| ||||||||||||||  ||||||| ||||||||    
24510308 ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt 24510258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #170
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 364 - 414
Target Start/End: Original strand, 39025106 - 39025156
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||| ||||||||||||||| |||||||||||||| ||||||||| ||||    
39025106 taaggttaaaatatggttttggtccctgcaaatatgtctcgttttgatttt 39025156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #171
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 45368847 - 45368793
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| ||||  || ||||||||||||||||||||||||||||| |||||    
45368847 ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgt 45368793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #172
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 15334916 - 15334965
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||| ||| ||| ||||||| |||||||||||||||    
15334916 aggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta 15334965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #173
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 364 - 417
Target Start/End: Original strand, 16083044 - 16083097
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||  |||| ||||||||| |||||||| ||||||||    
16083044 taaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagt 16083097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #174
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 21383103 - 21383160
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||  ||||||| |||||| ||||||||||||||||| |||||    
21383103 aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt 21383160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #175
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 21383429 - 21383372
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||| |||| |||||||||||||| ||||| ||||||| |||||    
21383429 aggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgt 21383372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #176
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 26062260 - 26062203
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||| ||||||||||||||  |||||| ||||||| ||| ||||||||||||||||||    
26062260 aaggttaaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg 26062203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #177
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 368 - 409
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttg 409  Q
    |||||||||||||||| ||||||||||||||||||| |||||    
26142671 gctaaaatatggttttaatccctgcaaatatgcctcattttg 26142630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #178
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 28507459 - 28507402
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| |||||| |||||||||||||| ||| |||| |||||||| |||||    
28507459 aggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgt 28507402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #179
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 365 - 414
Target Start/End: Original strand, 34002633 - 34002682
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||| |||| ||||| |||||||||||||| ||||||||||||||    
34002633 aaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt 34002682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #180
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 423
Target Start/End: Original strand, 34808200 - 34808253
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||  ||||| |||||||| ||||||||||||||||| |||||    
34808200 taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgt 34808253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #181
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 460
Target Start/End: Complemental strand, 41739121 - 41739029
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattt 460  Q
    ||||||||||||||||||  |||||||||||||   |||||||||||||||| |||||         || ||||||||||||||||||||||||||    
41739121 aggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgtaaatttttgtttttgtttttggtccctgcaaaatattt 41739029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #182
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 49923819 - 49923762
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||| ||||| || |||||||||||| |||||||| ||||||| |||||    
49923819 aggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgt 49923762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #183
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 364 - 416
Target Start/End: Complemental strand, 4360629 - 4360577
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 416  Q
    ||||||||||||||||||||  |||||||||||||| ||||||  ||||||||    
4360629 taaggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttag 4360577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #184
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 366 - 414
Target Start/End: Complemental strand, 8364917 - 8364869
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    |||||||||||| |||||| |||| ||||||||| ||||||||||||||    
8364917 aggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt 8364869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #185
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 21391376 - 21391324
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||  |||||| |||||||||||||||| ||||||||    
21391376 aaggttaaaatatggttttagtccctgtaaatatgcctcgttttagttttagt 21391324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #186
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 366 - 414
Target Start/End: Original strand, 33067347 - 33067395
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||||||||  ||| |||||||||| ||||||||||||||    
33067347 aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt 33067395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #187
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 26142419 - 26142470
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| |||||  || | |||||||||||||||||||||||||||    
26142419 aggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagt 26142470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #188
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 26699607 - 26699557
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| ||| ||||||||||| ||||||| ||||||||    
26699607 aggctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttttagt 26699557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #189
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 368 - 423
Target Start/End: Complemental strand, 33067729 - 33067674
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||| |||||  ||| |||||||||| ||||||||||||||| |||||||    
33067729 gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctgt 33067674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #190
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 33380257 - 33380206
Alignment:
367 ggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||| |  |||| ||||||||||||||||||||||||||    
33380257 ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagt 33380206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #191
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 414
Target Start/End: Complemental strand, 7350663 - 7350629
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||| |||||||||||||||||||||||||||||    
7350663 ttttggtccctgcaaatatgcctcgttttggtttt 7350629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #192
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 417
Target Start/End: Original strand, 20756015 - 20756069
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||| ||||||||| |||| |||| || ||||||| |||||||||||||||||    
20756015 ttaaggttaaaatatgattttaatccttgtaaatatgtctcgttttggttttagt 20756069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #193
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 414
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||| |||||||||||||||||||||||||||||    
28507188 ttttggtccctgcaaatatgcctcgttttggtttt 28507222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #194
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 408
Target Start/End: Complemental strand, 32035789 - 32035747
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgtttt 408  Q
    ||||||||||||||||||| |||||||||||||| || |||||    
32035789 aggctaaaatatggttttggtccctgcaaatatgtcttgtttt 32035747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #195
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 376 - 417
Target Start/End: Original strand, 292868 - 292909
Alignment:
376 atggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||  |||||||||||||||||||||||| |||||||    
292868 atggttttagtccctgcaaatatgcctcgttttgcttttagt 292909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #196
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 16083394 - 16083349
Alignment:
372 aaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||  ||||||||||||| |||||||||| |||||||    
16083394 aaatatggttttagtccctgcaaatatacctcgttttgattttagt 16083349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #197
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 423
Target Start/End: Original strand, 18302072 - 18302109
Alignment:
386 tccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||| ||||||||||||||||| |||||    
18302072 tccctgcaaatatgtctcgttttggttttagtccctgt 18302109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #198
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 368 - 417
Target Start/End: Original strand, 34382948 - 34382996
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||  ||||||||||||| ||||| ||||||||||||    
34382948 gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagt 34382996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #199
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 50428872 - 50428921
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||  ||| |||||||||| ||||||||| |||||    
50428872 aggctaaaatatggttttagtccttgcaaatatgtctcgttttgctttta 50428921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #200
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 5 - 101
Target Start/End: Original strand, 11896337 - 11896432
Alignment:
5 agtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtg 101  Q
    |||||||||| ||||||||||   || |||| |||||||||||||||||||||| | || |||| ||||  ||  | |||||||||||| |||||||    
11896337 agtttggtgt-cagatcaatgattgaagtgttcatgattatttggtgtggtttatagcaaatgaaaacaagcacaccaatttatagaagtttatgtg 11896432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #201
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 15466132 - 15466188
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||| | |  ||||||||| ||||||||||||| |||||    
15466132 ggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctgt 15466188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #202
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 434 - 462
Target Start/End: Complemental strand, 19622951 - 19622923
Alignment:
434 attgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||||||||||||||    
19622951 attgtttttggtccctgcaaaatattttg 19622923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #203
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 422
Target Start/End: Original strand, 30962415 - 30962471
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||  ||| |||||||||||||| |  |||||||||||||| ||||    
30962415 aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg 30962471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #204
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 31404723 - 31404667
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| ||||| |||| ||| |||||| | |||||||| ||||    
31404723 aggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg 31404667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #205
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Original strand, 46073884 - 46073916
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||| |||||||||||||||||||    
46073884 aggctaaaatatgcttttgatccctgcaaatat 46073916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #206
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 46868224 - 46868276
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||| |||| ||||  ||||||||||||||| || |||||||||||||    
46868224 aaggctaaattatgattttagtccctgcaaatatgcttcattttggttttagt 46868276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #207
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 414
Target Start/End: Complemental strand, 49074054 - 49074006
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||||||||||||||||| ||| || |||||||| |||||||| ||||    
49074054 aggctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt 49074006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 82707 - 82650
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
82707 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 82650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 82335 - 82396
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||||| |||||||||||| | ||||||||||||||||| ||||    
82335 ttttaaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 82396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 75358 - 75455
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
75358 aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 75455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 366 - 422
Target Start/End: Complemental strand, 75765 - 75709
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
75765 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 75709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 366278 - 366217
Alignment:
362 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
366278 tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 366217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 365979 - 366035
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||    
365979 ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgt 366035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 423
Target Start/End: Original strand, 2775 - 2834
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
2775 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 2834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 422
Target Start/End: Original strand, 8541 - 8602
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||| ||||  |||||||||||||||||||||||||||||||| ||||    
8541 ttttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 8602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 14696 - 14753
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
14696 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 14753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 15013 - 14956
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| ||| ||||||||||||| |||||    
15013 aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt 14956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 3292 - 3235
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||    
3292 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt 3235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 27365 - 27308
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
27365 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 27308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 414
Target Start/End: Original strand, 27072 - 27106
Alignment:
380 ttttgatccctgcaaatatgcctcgttttggtttt 414  Q
    ||||| |||||||||||||||||||||||||||||    
27072 ttttggtccctgcaaatatgcctcgttttggtttt 27106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 46; Significance: 5e-17; HSPs: 3)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 47923 - 47980
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
47923 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 47980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 370 - 417
Target Start/End: Complemental strand, 48228 - 48181
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||| |||||||||||||||||| |||||||||||||    
48228 taaaatatggttttggtccctgcaaatatgcctcattttggttttagt 48181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 360 - 417
Target Start/End: Complemental strand, 223179 - 223122
Alignment:
360 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||| ||||||||||||||||||| |||||||||||||| |||  ||||||||||||    
223179 gtttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagt 223122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 2666 - 2610
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||    
2666 tttttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagt 2610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 2333 - 2382
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||| |||||||||||| ||||||||||||| ||| ||||||||||||    
2333 aggctataatatggttttggtccctgcaaatattccttgttttggtttta 2382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 9028 - 8972
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
9028 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 8972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 369 - 423
Target Start/End: Original strand, 8734 - 8788
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
8734 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 8788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 45; Significance: 2e-16; HSPs: 4)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 4290 - 4238
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
4290 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 4238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 19472 - 19420
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
19472 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 19420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 4040 - 4091
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
4040 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 4091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 19222 - 19273
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
19222 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 19273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 22061 - 22005
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||    
22061 ttttaaggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagt 22005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 399
Target Start/End: Original strand, 21694 - 21728
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatg 399  Q
    |||||||||||||||||||||||||||||||||||    
21694 aaggctaaaatatggttttgatccctgcaaatatg 21728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 148282 - 148226
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
148282 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 148226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 147888 - 147937
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||| |||||||||||||  |||||||| ||||||||    
147888 aaggctaaaatatggttttg-tccctgcaaatat--ctcgttttagttttagt 147937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 44; Significance: 8e-16; HSPs: 3)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 365 - 459
Target Start/End: Original strand, 54813 - 54908
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatt 459  Q
    |||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
54813 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 54908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
50075 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 50023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 370 - 422
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
55176 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 55124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 44; Significance: 8e-16; HSPs: 2)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 366 - 417
Target Start/End: Original strand, 2500 - 2551
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||||||||||||||||||||||||||| |||||||| |||||||    
2500 aggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagt 2551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 367 - 409
Target Start/End: Complemental strand, 2883 - 2841
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttg 409  Q
    |||||||||||||||||| |||||||||||||| |||||||||    
2883 ggctaaaatatggttttggtccctgcaaatatgtctcgttttg 2841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 415
Target Start/End: Original strand, 5207 - 5257
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||    
5207 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 5257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 415
Target Start/End: Original strand, 5227 - 5277
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||    
5227 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 5277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 364 - 422
Target Start/End: Complemental strand, 292 - 234
Alignment:
364 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
292 taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 3920 - 3862
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
3920 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt 3862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 3532 - 3582
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
3532 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 3582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 1309 - 1366
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
1309 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 1366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 365 - 422
Target Start/End: Complemental strand, 1646 - 1589
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||||||  |||  |||||||||||||||||||||||||||||||| ||||    
1646 aaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg 1589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 35085 - 35028
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||||||| | |||||||| ||||||||||||||||| |||||    
35085 aggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgt 35028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 370 - 461
Target Start/End: Original strand, 34724 - 34816
Alignment:
370 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnttattgtttttggtccctgcaaaatatttt 461  Q
    ||||||||||||||| | ||||||||||||| || ||||| ||||| |||||||         || |||||||||||||||||||||||||||    
34724 taaaatatggttttgtttcctgcaaatatgcttcattttgattttaattcctgtaatttttttttgttgtttttggtccctgcaaaatatttt 34816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 423
Target Start/End: Complemental strand, 10516 - 10459
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  |||||||||||||| || ||||||||||||||||||||    
10516 aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt 10459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Original strand, 10168 - 10218
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||  ||||||||||||||||| ||||||||||||||    
10168 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 10218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 3)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 366 - 419
Target Start/End: Original strand, 189328 - 189381
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 419  Q
    |||||||||||| |||||||| |||| |||||||||||||||||||||||||||    
189328 aggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagttc 189381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 365 - 415
Target Start/End: Complemental strand, 189680 - 189630
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||| |||||  || ||||||||||||||| |||||||||||    
189680 aaggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta 189630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 61630 - 61687
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||| ||| |||||||||||||||   |||||| ||||||| ||||    
61630 aaggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg 61687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 5397 - 5449
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  ||||||||||||||||| ||||||||||||||    
5397 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 5449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 363 - 422
Target Start/End: Complemental strand, 5712 - 5653
Alignment:
363 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||||||||||  |||||||||||||| || |||||||||||||| ||||    
5712 ttaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg 5653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 12182 - 12238
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  ||||||||||||||||||||||| |||||||| |||||    
12182 ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgt 12238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 12536 - 12486
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||| ||||  ||||||||||||||||||||||||||||||||    
12536 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 12486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 462
Target Start/End: Original strand, 12525 - 12620
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnttattgtttttggtccctgcaaaatattttg 462  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| | |||          ||||||||||||||||||||||| |||||    
12525 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaaattgtttttggtccctgcaaaattttttg 12620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 367 - 422
Target Start/End: Original strand, 34931 - 34986
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    |||||||||||||| ||  |||||||||||||||||||||||||||||||| ||||    
34931 ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg 34986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 367 - 413
Target Start/End: Complemental strand, 4312 - 4266
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 413  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||    
4312 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt 4266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 374 - 422
Target Start/End: Original strand, 4016 - 4064
Alignment:
374 atatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 422  Q
    ||||||||||  ||||| |||||||||||||||||||||||||| ||||    
4016 atatggttttagtccctacaaatatgcctcgttttggttttagtccctg 4064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 423
Target Start/End: Complemental strand, 18049 - 17987
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||||||  ||||||| ||||||||||||||||| |||||| |||||    
18049 tttttaggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgt 17987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 423
Target Start/End: Original strand, 24371 - 24428
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    ||||||||||||||||||  || ||||||||||| ||||||||||||||||| |||||    
24371 aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt 24428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 3751 - 3800
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||| ||||||||||||||| | ||||||||||||    
3751 aggctaaaatatggttttggtccctgcaaatatgctttgttttggtttta 3800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 366 - 417
Target Start/End: Complemental strand, 4080 - 4029
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| ||||||| |||||||||||||| |||||||| ||||||||    
4080 aggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagt 4029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 366 - 415
Target Start/End: Original strand, 94056 - 94105
Alignment:
366 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||||  ||||| ||||||||||||||||||||||||    
94056 aggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta 94105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 368 - 415
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
368 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||||||  ||||| ||||||||||||||||||||||||    
94329 gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta 94282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Original strand, 16724 - 16780
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||| ||||| |||||||||||||  ||||||||||||||||| |||||    
16724 ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgt 16780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 367 - 423
Target Start/End: Complemental strand, 17966 - 17910
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||||||||||||||||  |||||||||||||||||||||| ||||| ||| |||||    
17966 ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt 17910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Original strand, 8328 - 8380
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| |||||||    
8328 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 8380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 417
Target Start/End: Complemental strand, 8644 - 8592
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| |||||||    
8644 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 8592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0578 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0578
Description:

Target: scaffold0578; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 365 - 423
Target Start/End: Complemental strand, 5072 - 5014
Alignment:
365 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 423  Q
    |||| ||||||||||||||| || ||||||||||  |||||||||||||||||| ||||    
5072 aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgt 5014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0472 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0472
Description:

Target: scaffold0472; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 361 - 415
Target Start/End: Complemental strand, 7270 - 7216
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    |||||||||||||||||| ||||| || ||||||||||| || ||||||||||||    
7270 ttttaaggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 7216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0204 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0204
Description:

Target: scaffold0204; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 369 - 421
Target Start/End: Original strand, 17126 - 17178
Alignment:
369 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 421  Q
    |||||||||||||||| ||||| ||||||||  | ||||||||||||||||||    
17126 ctaaaatatggttttggtccctccaaatatgtttggttttggttttagttcct 17178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 367 - 415
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 415  Q
    ||||||||||||| |||| ||||||||||||||| || |||||||||||    
44206 ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta 44158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 417
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
367 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 417  Q
    ||||||||||| |||||  | |||||||||||| |||||||||||||||||    
3455 ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 3405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0562 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0562
Description:

Target: scaffold0562; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 398
Target Start/End: Original strand, 9916 - 9953
Alignment:
361 ttttaaggctaaaatatggttttgatccctgcaaatat 398  Q
    |||| ||||||||||||| |||||||||||||||||||    
9916 tttttaggctaaaatatgcttttgatccctgcaaatat 9953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0106 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0106
Description:

Target: scaffold0106; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 366 - 398
Target Start/End: Complemental strand, 30967 - 30935
Alignment:
366 aggctaaaatatggttttgatccctgcaaatat 398  Q
    ||||||||||||||||||| |||||||||||||    
30967 aggctaaaatatggttttggtccctgcaaatat 30935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University