View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7584_low_11 (Length: 347)
Name: NF7584_low_11
Description: NF7584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7584_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 2536198 - 2535860
Alignment:
| Q |
1 |
tgcctggttttcgtcatcagaacccaccaccagcgagggccgtaattctcttcttagcacatttcgagtcagttctgcttgtgttgtattcgatggcacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2536198 |
tgcctggttttcgtcatcagaacccaccaccagcaatggccgtaattctcttcttagcacatttcgagtcagttctgcttgtgttgtattcgatggcacg |
2536099 |
T |
|
| Q |
101 |
ctttgttccagatctggccggtaccagagtgaactgggcctatggcaggcttccatgggcttaaaagtgaggggtttgactttggcatcataattgaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2536098 |
ctttgttccagatctggccggtaccggagtgaactgggcctatggcaggcttccatgggcttaaaagtgaggggtttgactttggcatcataattgaatt |
2535999 |
T |
|
| Q |
201 |
agttttccacttgaagaaatatgtcactcacactcttagtataaatccccctccttacatattccaaaaaaccaaacaaaagctcaatcctcaaccccac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
2535998 |
agttttccacttgaagaaatatgtcactcacactcttagtataaatccccctccttacatattccaaaaaaccaaacaaaagctcactcctcaatcccac |
2535899 |
T |
|
| Q |
301 |
tgattaactcctcaactcttcttcagctgtcttcatctc |
339 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2535898 |
taattaactcctcaactcttcttcagctgtcttcatctc |
2535860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University