View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7585_low_3 (Length: 416)
Name: NF7585_low_3
Description: NF7585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7585_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 6e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 15 - 171
Target Start/End: Complemental strand, 16274297 - 16274141
Alignment:
| Q |
15 |
agttaggactaaattgacggattttcatatactttatggaccaaattgagtgttaattaaacgaaaaagcgattcaaaatgaaaaactgaattgaagaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16274297 |
agttaggactaaattgacggattttcatatactttatggaccaaattgagtgttaattaaacgaaaaatcgattcaaaatgaaaaactgaattgaagaat |
16274198 |
T |
 |
| Q |
115 |
tttggaaaacctggattagaagatggtgttgttgagtggcggaacgttctctgtcct |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16274197 |
tttggaaaacctggattagaagatggtgttgttgagtggcggaacgttctctgtcct |
16274141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 235 - 401
Target Start/End: Complemental strand, 16274077 - 16273911
Alignment:
| Q |
235 |
ttcgttaccctgagatctcgaacttcggttatgagagattgtagttgaagcttcaacttcgaaaatttcagtaactccannnnnnnnnnnnctactttgc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16274077 |
ttcgttaccctgagatctcgaacttcggttatgagagattgtagttgaagcttcaacttcgaaaatttcagtaactccatttttgttttttctactttgc |
16273978 |
T |
 |
| Q |
335 |
gttttcaaatcaaggagcattttatattctggaaaacgttttcaaacgacaacgtttatggtgcgtg |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16273977 |
gttttcaaatcaaggagcattttatattctggaaaacgttttcaaacgacgacgtttatggtgcgtg |
16273911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 49
Target Start/End: Original strand, 39606098 - 39606127
Alignment:
| Q |
20 |
ggactaaattgacggattttcatatacttt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39606098 |
ggactaaattgacggattttcatatacttt |
39606127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University