View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7586_high_3 (Length: 265)
Name: NF7586_high_3
Description: NF7586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7586_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 25254379 - 25254137
Alignment:
| Q |
11 |
gaacctgtgaaggaaataccttggggattaattttgtcgaaaccaccagtctgggccctgattgtgtcccacttttgccacaactggggaactttcattc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25254379 |
gaacctgtgaaggaaataccttggggattaattttgtcgaaaccaccggtctgggccctgattgtgtcccacttttgccacaactggggaactttcattc |
25254280 |
T |
 |
| Q |
111 |
ttcttacatggatgccaacatactataatcaagtaagcc---nnnnnnnnnggattgtttgctaagtatgctgtttggtgttgacgaagttagattcgtt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25254279 |
ttcttacatggatgccaacatactataatcaagtaagccttttttttttttggattgtttgctaagtatgctgtttggtgtggacgaagttagattcgtt |
25254180 |
T |
 |
| Q |
208 |
cttatatatattttttcttctttttatgtcttacattgatgtc |
250 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
25254179 |
cttatatatactttttcttctttttatgtcttacattgctgtc |
25254137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University