View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7587_high_16 (Length: 244)
Name: NF7587_high_16
Description: NF7587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7587_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 37610158 - 37609945
Alignment:
| Q |
1 |
cacaacatcacatcagatgtaattaaatattaatattgtttagaaataatcgtcatttttaaataattgccattctttcattaatagctctagatagcag |
100 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37610158 |
cacaacatcacatcatatttaattaaatattaatattgtttagaaataatcgtcatttttaaataattgccattctttcattaatagctctagatagcag |
37610059 |
T |
|
| Q |
101 |
ataaattgatagttgaatgtatttaagcttgtagattgatttttgttttacaagtaatttaatgactataaatttatctttaagatgaataagagggagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37610058 |
ataaattgatagttgaatgtatttaagtgtgtagattgatttttgttttacaagtaatttaatgactataaatttatcgttaagatgaataagagggagt |
37609959 |
T |
|
| Q |
201 |
ttaaagtttaaact |
214 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
37609958 |
ttaaagtttgaact |
37609945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University