View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7587_low_5 (Length: 480)
Name: NF7587_low_5
Description: NF7587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7587_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 3e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 15 - 158
Target Start/End: Original strand, 24941856 - 24941999
Alignment:
| Q |
15 |
tggacatccaccccagtctgaatcattctaaaagataaacttattgatggaggaaggatacatgtgcaggctgggatcaataatgccctgaatatagtga |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24941856 |
tggacatccaccccagtctgaatcattgtaaaagataagcttattgatggaggaaggatacacgtgaaggctgggatcaataatgccctgaatatagtga |
24941955 |
T |
 |
| Q |
115 |
atgatgcgcttcaatgccgacatatgttgtatttttggattacg |
158 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24941956 |
atgacgcgcttcaatgccgacatatgttgtgtttttggattacg |
24941999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University