View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7588_high_1 (Length: 311)
Name: NF7588_high_1
Description: NF7588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7588_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 13 - 291
Target Start/End: Complemental strand, 20223454 - 20223177
Alignment:
| Q |
13 |
cttttttctgtgaaaatgcaaaataaagaaatattatgaatggaaataatttatcaaaatattaagataagatattaaagaataattgaaagagaatgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20223454 |
cttttttctgtgaaaatgcaaaataaagaaatattatgaatggaaataatttatcaaaattttaagataagatattaaagaataattgaaagagaatgaa |
20223355 |
T |
|
| Q |
113 |
cctgtagtgaagaatttttggcatagctagttttgccaactcctccagtcatatgaaacactttctctacatccannnnnnncttgggtttcttaagtta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
20223354 |
cctgtagtgaagaatttttggcatagctagttttgccaactcctccagtcatatgaaacactttctctacatccatttttttcttggttttctt-agtta |
20223256 |
T |
|
| Q |
213 |
gaattggactttctagttctggcttgatgaagaagttgtggtcatgttttaaagcaaatttccatgacgtggccattcc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20223255 |
gaattggactttctagttctggcttgatgaagaagttgtggtcatgttttaaagcaaatttccatgacgtggccattcc |
20223177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 289
Target Start/End: Complemental strand, 25330221 - 25330190
Alignment:
| Q |
258 |
gttttaaagcaaatttccatgacgtggccatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25330221 |
gttttaaagcaaatttccatgacgtggccatt |
25330190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University