View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7589_high_4 (Length: 468)
Name: NF7589_high_4
Description: NF7589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7589_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 41 - 134
Target Start/End: Original strand, 45671054 - 45671144
Alignment:
| Q |
41 |
tagcttccaattgatttacaacaatattttgaaaaacccgcgtatgctctgccattgagggaataagatttggtgttgtaacggctagagaaat |
134 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671054 |
tagcttccaattgatttacaa---tattttgaaaaacccgcgtatgctctgccattgagggaataagatttggtgttgtaacggctagagaaat |
45671144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University