View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7589_low_3 (Length: 511)
Name: NF7589_low_3
Description: NF7589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7589_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 3e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 84 - 177
Target Start/End: Original strand, 45671054 - 45671144
Alignment:
| Q |
84 |
tagcttccaattgatttacaacaatattttgaaaaacccgcgtatgctctgccattgagggaataagatttggtgttgtaacggctagagaaat |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671054 |
tagcttccaattgatttacaa---tattttgaaaaacccgcgtatgctctgccattgagggaataagatttggtgttgtaacggctagagaaat |
45671144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 45670059 - 45670122
Alignment:
| Q |
20 |
tcttggagagtgcaaacaactttataaagctgaacctcaaacttttaggacccaaaataacttt |
83 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
45670059 |
tcttggagagtgcaaacaactccatagagctgaacctcaaacttttaagacccaaaatatcttt |
45670122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University