View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7589_low_4 (Length: 468)

Name: NF7589_low_4
Description: NF7589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7589_low_4
NF7589_low_4
[»] chr1 (1 HSPs)
chr1 (41-134)||(45671054-45671144)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 41 - 134
Target Start/End: Original strand, 45671054 - 45671144
Alignment:
41 tagcttccaattgatttacaacaatattttgaaaaacccgcgtatgctctgccattgagggaataagatttggtgttgtaacggctagagaaat 134  Q
    |||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45671054 tagcttccaattgatttacaa---tattttgaaaaacccgcgtatgctctgccattgagggaataagatttggtgttgtaacggctagagaaat 45671144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University