View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7589_low_6 (Length: 270)
Name: NF7589_low_6
Description: NF7589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7589_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 17 - 154
Target Start/End: Complemental strand, 26799865 - 26799729
Alignment:
| Q |
17 |
ctttcatgatttattatgggaaaaagattagtggacaccaaatacccttagatagggttatggaatatattgcttagnnnnnnntgaagtattcttgtaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
26799865 |
ctttcatgatttattatgggaaaaagattagtggacaccaaaaacccttagatagggttatggaatatattgcttag-aaaaaatgaagtattctagtaa |
26799767 |
T |
 |
| Q |
117 |
gtatagaagaaatgaaggtgtacatgtattattgttct |
154 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26799766 |
gtgtagaagaaatgaaggtggacatgtattattgttct |
26799729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 164 - 255
Target Start/End: Complemental strand, 26799633 - 26799542
Alignment:
| Q |
164 |
agaaatggtctcaagtaattttttgttgcttatgcttatgagaaattatgtggtttcaaccgaattggtggtgattcaccttggtctcgtgt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26799633 |
agaaatggtctcaagtaattttttgttgcttatgcttatgagaggttatgtggtttcaaccgaattggtggtgattcaccttggtctcgtgt |
26799542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University