View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7590_high_12 (Length: 384)
Name: NF7590_high_12
Description: NF7590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7590_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 19 - 368
Target Start/End: Complemental strand, 50742615 - 50742263
Alignment:
| Q |
19 |
aaacatggcttatttatttacttttgcagaagaagaaaatgggtttttctttggtctagcgacagcaccggcacatgttgaagacaggcttgatgatgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50742615 |
aaacatggcttatttatttacttttgcagaagaagaaaatgggtttttctttggtctagcgacagcaccggcgcatgttgaagacaggcttgatgatgct |
50742516 |
T |
|
| Q |
119 |
tggattcagtttgctgaacaagagagtgttgccggtgctgagcagaaagtagatgctttgatgggctctgccactgctgatggtgggtctcaacaagccg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50742515 |
tggattcagtttgctgaacaagagagtgttgccggtgctgagcagaaagtagatgctttgatgggctctgccactgctgatggtgggtctcaacaagccg |
50742416 |
T |
|
| Q |
219 |
tatcatctgcacaacgagggcttaagggtaacaagaagtctcttaaggtagctatggaggccatgatcagaggatttgagaaatacatggaagtagatgg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50742415 |
tatcatctgcacaacgagggcttaagggtaacaaaaagtctcttaaggtagctatggaggccatgatcagaggatttgagaagtacatggaagtagatgg |
50742316 |
T |
|
| Q |
319 |
acaggaaggagaagaaga---agaacacattcctaatgtaactgcttggcata |
368 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50742315 |
acaggaaggagaagaagaagaagaacacattcctaatgtaactgcttggcata |
50742263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University