View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7590_high_14 (Length: 367)
Name: NF7590_high_14
Description: NF7590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7590_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 339; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 9 - 351
Target Start/End: Complemental strand, 39945052 - 39944710
Alignment:
| Q |
9 |
gaagaatatgaatttaagataatctggtgaccaaacatatcctacaaccgcagttcctgcttcacaaaaaccataatcaggacaagcgtaaccacctttt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39945052 |
gaagaaaatgaatttaagataatctggtgaccaaacatatcctacaaccgcagttcctgcttcacaaaaaccataatcaggacaagcgtaaccacctttt |
39944953 |
T |
 |
| Q |
109 |
gttgtatcttcttgccaaacaccgcccggtggactaattactgactgaaaagtcatagttgcaatcacagttgctgctaccattaattgttctcttgtct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944952 |
gttgtatcttcttgccaaacaccgcccggtggactaattactgactgaaaagtcatagttgcaatcacagttgctgctaccattaattgttctcttgtct |
39944853 |
T |
 |
| Q |
209 |
ttttatctatccaataaccttggtttatcaggtatttattgcagaaactctcaaccctgtcccatctattgtgttcatgttgttcattagctatgcttgg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944852 |
ttttatctatccaataaccttggtttatcaggtatttattgcagaaactctcaaccctgtcccatctattgtgttcatgttgttcattagctatgcttgg |
39944753 |
T |
 |
| Q |
309 |
tgttggtgaagggtcgtcacttggtgagaatggcggtggtggt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944752 |
tgttggtgaagggtcgtcacttggtgagaatggcggtggtggt |
39944710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 110 - 231
Target Start/End: Complemental strand, 39949296 - 39949175
Alignment:
| Q |
110 |
ttgtatcttcttgccaaacaccgcccggtggactaattactgactgaaaagtcatagttgcaatcacagttgctgctaccattaattgttctcttgtctt |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| ||||| ||||| ||||| || ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
39949296 |
ttgtatcttcttgccaaacaccgcctggtggacttattactgattgaaatgtcattgttgcgattacagttgctgctaccatggattgttcttttgtctt |
39949197 |
T |
 |
| Q |
210 |
tttatctatccaataaccttgg |
231 |
Q |
| |
|
|||||| ||||||| ||||||| |
|
|
| T |
39949196 |
tttatcaatccaattaccttgg |
39949175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 111 - 182
Target Start/End: Original strand, 29671522 - 29671593
Alignment:
| Q |
111 |
tgtatcttcttgccaaacaccgcccggtggactaattactgactgaaaagtcatagttgcaatcacagttgc |
182 |
Q |
| |
|
||||| ||||||||||||||| || |||||||| ||| | || ||||||||||| || ||||| |||||||| |
|
|
| T |
29671522 |
tgtattttcttgccaaacaccacctggtggacttattgcggattgaaaagtcattgtggcaattacagttgc |
29671593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University