View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7590_low_13 (Length: 390)
Name: NF7590_low_13
Description: NF7590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7590_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 39191436 - 39191568
Alignment:
| Q |
13 |
aatatgtacgtatttgaatgtcaaagaatgcaaacaaagtatagtagaataatttatcaaggatgttgcatgttagtgtcactaagtgtacaattattct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39191436 |
aatatgtacgtatttgaatgtcaaagaatgcaaacaaagtatagtagaataatt-atcaagtatgttgcatgttagtgtcactaagtgtacaattattct |
39191534 |
T |
 |
| Q |
113 |
ttgcaattttctctataaattgcagttcatacaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39191535 |
ttgcaattttctctataaattgcagttcatacaa |
39191568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University